PERLRETUT(1perl)
💖 NAME 💖
perlretut — the Perl regular expressions tutorial, bestie edition 🦋
✨ DESCRIPTION ✨
Okay so, this page is your lil' intro course on understanding, creating, and using regular expressions in Perl. It's the friendly companion to the big reference page perlre. Regexps are literally baked into the m//, s///, qr// and split operators, so this tutorial also overlaps with "Regexp Quote-Like Operators" in perlop and "split" in perlfunc. iykyk 💅
Perl is famous for being amazing at text processing, and regular expressions are a huge part of why. Perl regexps have an efficiency and flexibility that most other computer languages simply don't have. Mastering even the basics lets you mess with text with surprising ease. no cap.
So what even is a regular expression? At its most basic, a regexp is a template used to figure out if a string has certain characteristics. Usually that string is text — a line, a sentence, a web page, even a whole book — but it doesn't have to be. It could be binary data, for example. Biologists use Perl all the time to hunt for patterns in long DNA sequences. iconic 🧬
Say we wanna know if the text in the variable $var contains the character sequence m u s h r o o m (spaces added so it's readable, they're not real). We write in Perl:
$var =~ m/mushroom/This expression is TRUE if $var contains that sequence of characters anywhere inside it, and FALSE otherwise. The part wrapped in / characters is the characteristic we're looking for. We call that the pattern. The process of checking whether the pattern shows up in the string is called matching, and the =~ operator together with the m// is what tells Perl to try matching the pattern against the string. Also, fun fact, the pattern is also a string — just a very special kind of one, as you'll see. Patterns are everywhere these days: the stuff you type into a search engine, the stuff you use to list files in a directory like "ls *.txt" or "dir *.*". And in Perl, regexp patterns don't just search strings — they also pull out the parts you want and do search-and-replace. obsessed. 🔥
Regular expressions have this totally undeserved reputation for being abstract and hard. The real reason they seem that way is just that the notation is terse and dense, not that there's any inherent complexity. Highly recommend using the /x regular expression modifier (described below) plus a whole lotta white space to make them less dense and way easier to read. Regexps are built from simple concepts like conditionals and loops — honestly no harder to understand than the if conditionals and while loops you already know in Perl itself. 💜
This tutorial flattens the learning curve by going through regexp concepts and their notation one at a time, with lots of examples. The first part goes from the simplest word searches up to the basic regexp concepts. If you master part one, you've got every tool you need for like 98% of your needs. The second part is for when you're comfy with the basics and hungry for more power tools — it covers the more advanced regular expression operators and the latest cutting-edge innovations. 👑
A note: to save time, "regular expression" gets shortened to regexp or regex. Regexp is the more natural abbreviation than regex, but it's harder to pronounce. The Perl pod documentation is evenly split on regexp vs regex — in Perl, there's more than one way to abbreviate it 😭. We'll use regexp in this tutorial.
New in v5.22: use re 'strict' applies stricter rules than usual when compiling regular expression patterns. It can catch things that, while legal, may not be what you actually intended.
🎀 Part 1: The basics 🎀
🌸 Simple word matching 🌸
The simplest regexp is just a word — or, more generally, a string of characters. A regexp made of a single word matches any string that contains that word:
"Hello World" =~ /World/; # matchesSo what is this Perl statement even doing? "Hello World" is just a simple double-quoted string. "World" is the regular expression, and the // wrapping it as /World/ tells Perl to search a string for a match. The =~ operator links the string to the regexp match and gives you a true value if the regexp matched, or false if it didn't. Here, "World" matches the second word in "Hello World", so the expression is true. Expressions like this are super useful in conditionals:
if ("Hello World" =~ /World/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}There are useful variations on this theme. You can flip the sense of the match with the !~ operator:
if ("Hello World" !~ /World/) {
print "It doesn't match\n";
}
else {
print "It matches\n";
}The literal string inside the regexp can be swapped for a variable:
my $greeting = "World";
if ("Hello World" =~ /$greeting/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}If you're matching against the special default variable $_, you can leave off the $_ =~ part entirely:
$_ = "Hello World";
if (/World/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}And finally, the // default delimiters for a match can be changed to literally any delimiters by putting an m out front:
"Hello World" =~ m!World!; # matches, delimited by '!'
"Hello World" =~ m{World}; # matches, note the paired '{}'
"/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
# '/' becomes an ordinary char/World/, m!World!, and m{World} all mean the exact same thing. When you use, say, the quote (") as a delimiter, the forward slash / becomes an ordinary character and you can use it in the regexp with zero trouble. slay ✨
Let's see how different regexps would match "Hello World":
"Hello World" =~ /world/; # doesn't match
"Hello World" =~ /o W/; # matches
"Hello World" =~ /oW/; # doesn't match
"Hello World" =~ /World /; # doesn't matchThe first regexp world doesn't match because regexps are case-sensitive by default. The second one matches because the substring o W shows up in "Hello World". The space character is treated like any other character in a regexp, and you need it to match here. That missing space is exactly why the third regexp oW fails. And the fourth regexp "World " doesn't match because there's a space at the end of the regexp, but not at the end of the string. Lesson: regexps have to match a part of the string exactly for the statement to be true. periodt.
If a regexp matches in more than one place in the string, Perl will always match at the earliest possible point in the string:
"Hello World" =~ /o/; # matches 'o' in 'Hello'
"That hat is red" =~ /hat/; # matches 'hat' in 'That'When it comes to character matching, there are a few more things you gotta know. First of all, not every character can just be used "as-is" in a match. Some characters — called metacharacters — are generally reserved for regexp notation. The metacharacters are:
{}[]()^$.|*+?-#\This list is not as definitive as it looks (or as other docs might claim it to be). For example, # is only a metacharacter when the /x pattern modifier (described below) is in play, and } and ] are metacharacters only when paired with an opening { or [ respectively; other gotchas apply too. 💀
What each of these actually does gets explained later in the tutorial, but for now the important bit is: a metacharacter can be matched as-is by putting a backslash before it. That's called "escaping" or "quoting" it. Examples:
"2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
"2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
"The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
"The interval is [0,1)." =~ /\[0,1\)\./ # matches
"#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/; # matchesIn that last regexp, the forward slash / is backslashed too, because it's what delimits the regexp. That can lead to LTS (leaning toothpick syndrome) though, so it's often way more readable to just change delimiters:
"#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to readThe backslash character \ is itself a metacharacter and needs to be backslashed:
'C:\WIN32' =~ /C:\\WIN/; # matchesWhen it doesn't make sense for a particular metacharacter to mean its normal thing, it automatically loses its metacharacter-ness and becomes an ordinary character matched literally. For example, } is only a metacharacter when it's the mate of a { metacharacter. Otherwise it's treated as a literal RIGHT CURLY BRACKET. This can cause unexpected results 🙈. use re 'strict' can catch some of these.
On top of the metacharacters, there are some ASCII characters with no printable equivalent that get represented by escape sequences instead. Common ones: \t for a tab, \n for a newline, \r for a carriage return, and \a for a bell (or alert). If it makes more sense to think of your string as a sequence of arbitrary bytes, the octal escape sequence like \033, or the hexadecimal escape sequence like \x1B, might be a more natural way to write your bytes. Here are some escape examples:
"1000\t2000" =~ m(0\t2) # matches
"1000\n2000" =~ /0\n20/ # matches
"1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
"cat" =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
# to spell catIf you've been around Perl for a while, all this escape sequence talk probably feels familiar. Similar escape sequences are used in double-quoted strings — and in fact, the regexps in Perl are mostly treated as double-quoted strings. Which means variables work in regexps too! Just like double-quoted strings, the values of variables in the regexp get substituted in before the regexp is evaluated for matching purposes. So we have:
$foo = 'house';
'housecat' =~ /$foo/; # matches
'cathouse' =~ /cat$foo/; # matches
'housecat' =~ /${foo}cat/; # matchesso far so good bestie 💖 like, with everything we've covered you can already search for pretty much ANY literal string regexp you could dream up. not me over here building regexps with just vibes and a variable. anyway here's a super simple emulation of the Unix grep program so you can see it in the wild:
% cat > simple_grep
#!/usr/bin/perl
$regexp = shift;
while (<>) {
print if /$regexp/;
}
^D
% chmod +x simple_grep
% simple_grep abba /usr/dict/words
Babbage
cabbage
cabbages
sabbath
Sabbathize
Sabbathizes
sabbatical
scabbard
scabbardsthis program is easy to understand, no cap. #!/usr/bin/perl is the standard way to invoke a perl program from the shell (shebang! iconic). $regexp = shift; saves the first command line argument as the regexp to be used, leaving the rest of the command line arguments to be treated as files. while (<>) loops over all the lines in all the files. and for each line, print if /$regexp/; prints the line if the regexp matches the line. in this line, both print and /$regexp/ use the default variable $_ implicitly — she's just quietly doing the work in the background, main character energy tbh 💅.
With all of the regexps above, if the regexp matched anywhere in the string, it was considered a match. sometimes though, we'd like to specify where in the string the regexp should try to match. to do this, we'd use the anchor metacharacters ^ and $. the anchor ^ means match at the beginning of the string, and the anchor $ means match at the end of the string, or before a newline at the end of the string. here's how they're used:
"housekeeper" =~ /keeper/; # matches
"housekeeper" =~ /^keeper/; # doesn't match
"housekeeper" =~ /keeper$/; # matches
"housekeeper\n" =~ /keeper$/; # matchesthe second regexp doesn't match because ^ constrains keeper to match only at the beginning of the string, but housekeeper has keeper starting in the middle 😭. the third regexp does match, since the $ constrains keeper to match only at the end of the string.
When both ^ and $ are used at the same time, the regexp has to match both the beginning and the end of the string, i.e., the regexp matches the whole string. consider:
"keeper" =~ /^keep$/; # doesn't match
"keeper" =~ /^keeper$/; # matches
"" =~ /^$/; # ^$ matches an empty stringthe first regexp doesn't match because the string has more to it than keep. since the second regexp is exactly the string, it matches ✨. using both ^ and $ in a regexp forces the complete string to match, so it gives you complete control over which strings match and which don't — literally you are the CEO of matching at that point 👑. suppose you're looking for a fellow named bert, off in a string by himself:
"dogbert" =~ /bert/; # matches, but not what you want
"dilbert" =~ /^bert/; # doesn't match, but ..
"bertram" =~ /^bert/; # matches, so still not good enough
"bertram" =~ /^bert$/; # doesn't match, good
"dilbert" =~ /^bert$/; # doesn't match, good
"bert" =~ /^bert$/; # matches, perfectof course, in the case of a literal string, one could just as easily use the string comparison $string eq 'bert' and it would be more efficient. the ^...$ regexp really becomes useful when we add in the more powerful regexp tools below 🔥.
🌸 Using character classes 🌸
although one can already do quite a lot with the literal string regexps above, we've only scratched the surface of regular expression technology. in this and subsequent sections we will introduce regexp concepts (and associated metacharacter notations) that will allow a regexp to represent not just a single character sequence, but a whole class of them. glow up incoming 🦋.
One such concept is that of a character class. a character class allows a set of possible characters, rather than just a single character, to match at a particular point in a regexp. you can define your own custom character classes — so DIY, so you. these are denoted by brackets [...], with the set of characters to be possibly matched inside. here are some examples:
/cat/; # matches 'cat'
/[bcr]at/; # matches 'bat, 'cat', or 'rat'
/item[0123456789]/; # matches 'item0' or ... or 'item9'
"abc" =~ /[cab]/; # matches 'a'in that last statement, even though c is the first character in the class, a matches because the first character position in the string is the earliest point at which the regexp can match.
/[yY][eE][sS]/; # match 'yes' in a case-insensitive way
# 'yes', 'Yes', 'YES', etc.This regexp displays a common task: perform a case-insensitive match. perl provides a way of avoiding all those brackets by simply appending an i to the end of the match. then /[yY][eE][sS]/; can be rewritten as /yes/i;. the i stands for case-insensitive and is an example of a modifier of the matching operation. we will meet other modifiers later in the tutorial 🌈.
We saw in the section above that there were ordinary characters, which represented themselves, and special characters, which needed a backslash \ to represent themselves. the same is true in a character class, but the sets of ordinary and special characters inside a character class are different than those outside a character class. the special characters for a character class are -]\^$ (and the pattern delimiter, whatever it is). ] is special because it denotes the end of a character class. $ is special because it denotes a scalar variable. \ is special because it is used in escape sequences, just like above. here's how the special characters ]$\ are handled:
/[\]]def/; # matches ']def' or 'cdef' — wait, see belowokay actually here's the real code, verbatim:
/[\]]def/; # matches ']def' or 'cdef'
$x = 'bcr';
/[$x]at/; # matches 'bat', 'cat', or 'rat'
/[\$x]at/; # matches '$at' or 'xat'
/[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'The last two are a little tricky. in [\$x], the backslash protects the dollar sign, so the character class has two members $ and x. In [\\$x], the backslash is protected, so $x is treated as a variable and substituted in double quote fashion. sneaky little backslash doing the most 💅.
The special character - acts as a range operator within character classes, so that a contiguous set of characters can be written as a range. with ranges, the unwieldy [0123456789] and [abc...xyz] become the svelte [0-9] and [a-z] ✨ (and if "svelte" as a word isn't a serve i don't know what is). some examples:
/item[0-9]/; # matches 'item0' or ... or 'item9'
/[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
# 'baa', 'xaa', 'yaa', or 'zaa'
/[0-9a-fA-F]/; # matches a hexadecimal digit
/[0-9a-zA-Z_]/; # matches a "word" character,
# like those in a Perl variable nameIf - is the first or last character in a character class, it is treated as an ordinary character; [-ab], [ab-] and [a\-b] are all equivalent.
The special character ^ in the first position of a character class denotes a negated character class, which matches any character but those in the brackets. both [...] and [^...] must match a character, or the match fails. so:
/[^a]at/; # doesn't match 'aat' or 'at', but matches
# all other 'bat', 'cat, '0at', '%at', etc.
/[^0-9]/; # matches a non-numeric character
/[a^]at/; # matches 'aat' or '^at'; here '^' is ordinaryNow, even [0-9] can be a bother to write multiple times, so in the interest of saving keystrokes and making regexps more readable, perl has several abbreviations for common character classes, as shown below. since the introduction of Unicode, unless the /a modifier is in effect, these character classes match more than just a few characters in the ASCII range 👀.
\dmatches a digit, not just[0-9]but also digits from non-roman scripts\smatches a whitespace character, the set[\ \t\r\n\f]and others\wmatches a word character (alphanumeric or_), not just[0-9a-zA-Z_]but also digits and characters from non-roman scripts\Dis a negated\d; it represents any other character than a digit, or[^\d]\Sis a negated\s; it represents any non-whitespace character[^\s]\Wis a negated\w; it represents any non-word character[^\w]- The period
.matches any character but\n(unless the modifier/sis in effect, as explained below). \N, like the period, matches any character but\n, but it does so regardless of whether the modifier/sis in effect.
The /a modifier, available starting in Perl 5.14, is used to restrict the matches of \d, \s, and \w to just those in the ASCII range. it's useful to keep your program from being needlessly exposed to full Unicode (and its accompanying security considerations) when all you want is to process English-like text. (the a may be doubled, /aa, to provide even more restrictions, preventing case-insensitive matching of ASCII with non-ASCII characters; otherwise a Unicode "Kelvin Sign" would caselessly match a k or K. truly the lore goes deep 🌈).
The \d\s\w\D\S\W abbreviations can be used both inside and outside of bracketed character classes. here are some in use:
/\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
/[\d\s]/; # matches any digit or whitespace character
/\w\W\w/; # matches a word char, followed by a
# non-word char, followed by a word char
/..rt/; # matches any two chars, followed by 'rt'
/end\./; # matches 'end.'
/end[.]/; # same thing, matches 'end.'Because a period is a metacharacter, it needs to be escaped to match as an ordinary period. and because, for example, \d and \w are sets of characters, it is incorrect to think of [^\d\w] as [\D\W]; in fact [^\d\w] is the same as [^\w], which is the same as [\W]. think De Morgan's laws 💀 (yes the math class jumped out, we contain multitudes).
In actuality, the period and \d\s\w\D\S\W abbreviations are themselves types of character classes, so the ones surrounded by brackets are just one type of character class. when we need to make a distinction, we refer to them as "bracketed character classes."
An anchor useful in basic regexps is the word anchor \b. this matches a boundary between a word character and a non-word character \w\W or \W\w:
$x = "Housecat catenates house and cat";
$x =~ /cat/; # matches cat in 'housecat'
$x =~ /\bcat/; # matches cat in 'catenates'
$x =~ /cat\b/; # matches cat in 'housecat'
$x =~ /\bcat\b/; # matches 'cat' at end of stringnote in the last example, the end of the string is considered a word boundary. bestie that's lowkey the most useful little anchor and nobody talks about it enough 🫶.
okay so for natural language processing (y'know, when you actually want the apostrophe to be part of the word), you'd reach for \b{wb} instead:
"don't" =~ / .+? \b{wb} /x; # matches the whole stringNow, bestie, you might be sitting there like "why does . match everything but \n?? why not every single character??" 💭 And honestly? The reason is that most of the time you're matching against lines, and you'd lowkey like to ignore the newline chars. Like, the string "\n" is technically one line, but we'd rather think of it as empty. So:
"" =~ /^$/; # matches
"\n" =~ /^$/; # matches, $ anchors before "\n"
"" =~ /./; # doesn't match; it needs a char
"" =~ /^.$/; # doesn't match; it needs a char
"\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
"a" =~ /^.$/; # matches
"a\n" =~ /^.$/; # matches, $ anchors before "\n"This behaviour is genuinely convenient, fr fr — because usually when we count and match characters in a line, we wanna ignore newlines. But sometimes? Sometimes we absolutely want to keep track of those newlines. We might even want ^ and $ to anchor at the beginning and end of lines within the string, not just the start and end of the whole string. And Perl? Perl lets us pick. 🫶 We choose between ignoring and paying attention to newlines with the /s and /m modifiers. They stand for single line and multi-line, and they decide whether a string gets treated as one continuous string or as a little set of lines.
These two modifiers affect two aspects of how the regexp is interpreted:
- how the
.character class is defined, and - where the anchors
^and$are able to match.
Here are the four possible combinations:
- no modifiers — Default behaviour.
.matches any character except\n.^matches only at the beginning of the string and$matches only at the end or before a newline at the end. - s modifier (
/s) — Treat the string as a single long line..matches any character, even\n.^matches only at the beginning of the string and$matches only at the end or before a newline at the end. - m modifier (
/m) — Treat the string as a set of multiple lines..matches any character except\n.^and$are able to match at the start or end of any line within the string. - both s and m modifiers (
/sm) — Treat the string as a single long line, but detect multiple lines..matches any character, even\n.^and$, however, are able to match at the start or end of any line within the string.
Here's /s and /m in action, live and direct ✨:
$x = "There once was a girl\nWho programmed in Perl\n";
$x =~ /^Who/; # doesn't match, "Who" not at start of string
$x =~ /^Who/s; # doesn't match, "Who" not at start of string
$x =~ /^Who/m; # matches, "Who" at start of second line
$x =~ /^Who/sm; # matches, "Who" at start of second line
$x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/s; # matches, "." matches "\n"
$x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/sm; # matches, "." matches "\n"Most of the time the default behaviour is exactly what you want, but /s and /m come in clutch occasionally. Oh, and if /m is being used, you can still match the start of the string with \A, and the end of the string with the anchors \Z (matches both the end and the newline before it, just like $) and \z (matches only the end):
$x =~ /^Who/m; # matches, "Who" at start of second line
$x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
$x =~ /girl$/m; # matches, "girl" at end of first line
$x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
$x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
$x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of stringSo now we know how to make choices among classes of characters in a regexp. But what about choices among words or character strings? 👀 That's the next section, babes.
💫 Matching this or that 💫
Sometimes we want our regexp to be able to match different possible words or character strings. This is done with the alternation metacharacter |. Wanna match "dog" or "cat"? You form the regexp dog|cat. Same as before, Perl tries to match the regexp at the earliest possible point in the string. At each character position, Perl first tries to match the first alternative, "dog". If "dog" doesn't match, Perl tries the next alternative, "cat". And if "cat" doesn't match either, the match fails and Perl moves on to the next position in the string. Examples:
"cats and dogs" =~ /cat|dog|bird/; # matches "cat"
"cats and dogs" =~ /dog|cat|bird/; # matches "cat"Even though "dog" is the first alternative in that second regexp, "cat" is able to match earlier in the string. periodt.
"cats" =~ /c|ca|cat|cats/; # matches "c"
"cats" =~ /cats|cat|ca|c/; # matches "cats"Here, all the alternatives match at the first string position, so the first alternative is the one that wins. So if some of your alternatives are truncations of others, put the longest ones first to give them a chance to match. 🧠
"cab" =~ /a|b|c/ # matches "c"
# /a|b|c/ == /[abc]/That last example is the glow-up reveal: character classes are basically alternations of characters. At a given character position, the first alternative that lets the regexp match succeed is the one that matches. 💅
👑 Grouping things and hierarchical matching 👑
Alternation lets a regexp choose among alternatives, but on its own it's kinda mid. Because each alternative is a whole regexp, and sometimes we only want alternatives for part of a regexp. Like, say we wanna search for housecats or housekeepers. The regexp housecat|housekeeper fits the bill, but it's inefficient because we had to type house twice. 😭 It would be so much nicer to have parts of the regexp be constant (like house) and some parts have alternatives (like cat|keeper).
Enter the grouping metacharacters (), here to solve everything. 🎀 Grouping lets parts of a regexp be treated as a single unit, and you group them by wrapping them in parentheses. So we could solve housecat|housekeeper by forming the regexp as house(cat|keeper). That means: match house followed by either cat or keeper. More examples, bestie:
/(a|b)b/; # matches 'ab' or 'bb'
/(ac|b)b/; # matches 'acb' or 'bb'
/(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
/(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
/house(cat|)/; # matches either 'housecat' or 'house'
/house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
# 'house'. Note groups can be nested.
/(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
"20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
# because '20\d\d' can't matchAlternations behave the same way inside groups as outside them: at a given string position, the leftmost alternative that allows the regexp to match is the one that gets taken. So in that last example, at the first string position "20" matches the second alternative — but then there's nothing left over to match the next two digits \d\d. So Perl moves on to the next alternative, which is the null alternative, and that works, because "20" is two digits. slay. ✨
The whole process of trying one alternative, seeing if it matches, and moving on to the next one — while stepping back in the string to where the previous alternative was tried if it didn't work — is called backtracking. The name comes from the idea that matching a regexp is like a walk in the woods. 🌲 Successfully matching a regexp is like arriving at a destination. There are many possible trailheads, one for each string position, and each one gets tried in order, left to right. From each trailhead there may be many paths — some get you there, some are dead ends. When you're walking a trail and hit a dead end, you have to backtrack along the trail to an earlier point to try another one. If you hit your destination you stop immediately and forget about all the other trails. You are persistent, and only if you've tried all the trails from all the trailheads and not arrived do you declare failure.
To be concrete, here's a step-by-step analysis of what Perl does when it tries to match the regexp
"abcde" =~ /(abd|abc)(df|d|de)/;- Start with the first letter in the string
'a'. - Try the first alternative in the first group
'abd'. - Match
'a'followed by'b'. So far so good. 'd'in the regexp doesn't match'c'in the string — a dead end. So backtrack two characters and pick the second alternative in the first group'abc'.- Match
'a'followed by'b'followed by'c'. We are on a roll and have satisfied the first group. Set$1to'abc'. - Move on to the second group and pick the first alternative
'df'. - Match the
'd'. 'f'in the regexp doesn't match'e'in the string, so a dead end. Backtrack one character and pick the second alternative in the second group'd'.'d'matches. The second grouping is satisfied, so set$2to'd'.- We are at the end of the regexp, so we are done! We have matched
'abcd'out of the string"abcde".
A couple things to note about all this. First, the third alternative in the second group 'de' also allows a match, but we stopped before we got to it — at a given character position, leftmost wins. Second, we were able to get a match at the first character position of the string, 'a'. If there were no matches at the first position, Perl would move to the second character position 'b' and attempt the match all over again. Only when all possible paths at all possible character positions have been exhausted does Perl give up and declare "$string =~ /(abd|abc)(df|d|de)/;" to be false. 💀
Even with all this work, regexp matching happens remarkably fast. To speed things up, Perl compiles the regexp into a compact sequence of opcodes that can often fit inside a processor cache. When the code is executed, these opcodes can then run at full throttle and search very quickly. 🔥
🎀 Extracting matches 🎀
The grouping metacharacters () also serve another completely different function: they let you extract the parts of a string that matched. This is super useful for finding out what matched, and for text processing in general. For each grouping, the part that matched inside goes into the special variables $1, $2, etc. And you can use them just like ordinary variables:
# extract hours, minutes, seconds
if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
$hours = $1;
$minutes = $2;
$seconds = $3;
}so quick reminder bestie 💖 in scalar context, $time =~ /(\d\d):(\d\d):(\d\d)/ hands you back a plain true-or-false value. but flip it into list context and it gives you the whole list of matched values, ($1,$2,$3). so we could totally write that same code more compactly, like:
# extract hours, minutes, seconds
($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);and if the groupings in your regexp are nested? then $1 grabs the group with the leftmost opening parenthesis, $2 gets the next opening parenthesis, and so on down the line. here's a regexp with nested groups:
/(ab(cd|ef)((gi)|j))/;
1 2 34if this regexp matches, then $1 contains a string starting with 'ab', $2 is either set to 'cd' or 'ef', $3 equals either 'gi' or 'j', and $4 is either set to 'gi' (just like $3) or it stays undefined. numbers don't lie 💅
for convenience, Perl sets $+ to the string held by the highest numbered $1, $2,... that actually got assigned (and, somewhat related, $^N to the value of the $1, $2,... that was most recently assigned; i.e. the $1, $2,... associated with the rightmost closing parenthesis used in the match). ok slay, noted 📝
✨ Backreferences ✨
so closely associated with the matching variables $1, $2, ... are the backreferences \g1, \g2,... backreferences are literally just matching variables that you're allowed to use inside a regexp. this feature is genuinely iconic; what matches later in a regexp gets made to depend on what matched earlier in the regexp. no cap.
say we wanted to hunt down doubled words in a text, like "the the". the following regexp finds all 3-letter doubles with a space in between:
/\b(\w\w\w)\s\g1\b/;see how the grouping assigns a value to \g1, so that the same 3-letter sequence gets used for both parts? that's the magic ✨
a similar task is finding words that are made of two identical parts:
% simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
beriberi
booboo
coco
mama
murmur
papathis regexp has a single grouping that considers 4-letter combinations, then 3-letter combinations, etc., and uses \g1 to look for a repeat. 🦋
even though $1 and \g1 represent the same thing, care should be taken to use matched variables $1, $2,... only outside a regexp and backreferences \g1, \g2,... only inside a regexp — not doing so may lead to surprising and unsatisfactory results. 😭
🌸 Relative backreferences 🌸
counting the opening parentheses to get the correct number for a backreference is error-prone the second there's more than one capturing group. bummer. but a more convenient technique showed up with Perl 5.10: relative backreferences. to refer to the immediately preceding capture group you now write \g-1 or \g{-1}, the next but last one is available via \g-2 or \g{-2}, and so on down the chain. 💅
another great reason (on top of readability and maintainability, which, obsessed) for using relative backreferences is shown by this example, where a simple pattern for matching peculiar strings gets used:
$a99a = '([a-z])(\d)\g2\g1'; # matches a11a, g22g, x33x, etc.now that we've got this pattern stored as a handy string, we might feel tempted to use it as part of some other pattern:
$line = "code=e99e";
if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior!
print "$1 is valid\n";
} else {
print "bad line: '$line'\n";
}but nope, this doesn't match — <dramatic>at least not the way one might expect</dramatic>. only after inserting the interpolated $a99a and staring at the resulting full text of the regexp is it obvious that the backreferences have backfired 💀 the subexpression (\w+) has snatched number 1 and demoted the groups in $a99a by one rank. this can be avoided by using relative backreferences:
$a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated🎀 Named backreferences 🎀
Perl 5.10 also introduced named capture groups and named backreferences. to attach a name to a capturing group, you write either (?<name>...) or (?'name'...). the backreference may then be written as \g{name}. it's permissible to attach the same name to more than one group, but then only the leftmost one of the eponymous set can be referenced. outside of the pattern, a named capture group is accessible through the %+ hash. 🫶
suppose we have to match calendar dates which may be given in one of three formats: yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy. we can write three suitable patterns where we use 'd', 'm' and 'y' respectively as the names of the groups capturing the pertaining components of a date. the matching operation combines the three patterns as alternatives:
$fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
$fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
$fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
for my $d (qw(2006-10-21 15.01.2007 10/31/2005)) {
if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
print "day=$+{d} month=$+{m} year=$+{y}\n";
}
}if any of the alternatives matches, the hash %+ is bound to contain the three key-value pairs. ate, no crumbs ✨
💜 Alternative capture group numbering 💜
yet another capturing group numbering technique (also from Perl 5.10, bestie's been busy) deals with the problem of referring to groups within a set of alternatives. consider a pattern for matching a time of the day, civil or military style:
if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
# process hour and minute
}processing the results requires an additional if statement to figure out whether $1 and $2 or $3 and $4 contain the goodies. annoying, right? it would be easier if we could use group numbers 1 and 2 in the second alternative as well — and that's exactly what the parenthesized construct (?|...), set around an alternative, achieves. here's an extended version of the previous pattern:
if($time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/){
print "hour=$1 minute=$2 zone=$3\n";
}within the alternative numbering group, group numbers start at the same position for each alternative. after the group, numbering continues with one higher than the maximum reached across all the alternatives. math is serving 💅
🔥 Position information 🔥
on top of what was matched, Perl also hands you the positions of what was matched, as contents of the @- and @+ arrays. $-[0] is the position of the start of the entire match and $+[0] is the position of the end. similarly, $-[n] is the position of the start of the $n match and $+[n] is the position of the end. and if $n is undefined, so are $-[n] and $+[n]. then this code:
$x = "Mmm...donut, thought Homer";
$x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
foreach $exp (1..$#-) {
no strict 'refs';
print "Match $exp: '$$exp' at position ($-[$exp],$+[$exp])\n";
}prints
Match 1: 'Mmm' at position (0,3)
Match 2: 'donut' at position (6,11)even if there are no groupings in a regexp, it's still possible to find out what exactly matched in a string. if you use them, Perl will set $`` to the part of the string <italic>before</italic> the match, will set $&to the part of the string that <italic>matched</italic>, and will set$'` to the part of the string after the match. example:
$x = "the cat caught the mouse";
$x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
$x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'in that second match, $`` equals ''` because the regexp matched at the first character position in the string and stopped; it never even saw the second "the". sneaky 🐈
⚠️ if your code is going to run on Perl versions earlier than 5.20, it's worth noting that using$`` and$'slows down regexp matching <red>quite a bit</red>, while$&` slows it down to a lesser extent — because if they're used in one regexp in a program, they get generated for all regexps in the program. so if raw performance is a goal of your application, they should be avoided. 😭
if you need to extract the corresponding substrings, use @- and @+ instead:
$` is the same as substr( $x, 0, $-[0] )
$& is the same as substr( $x, $-[0], $+[0]-$-[0] )
$' is the same as substr( $x, $+[0] )as of Perl 5.10, the ${^PREMATCH}, ${^MATCH} and ${^POSTMATCH} variables may be used. these are only set if the /p modifier is present, which means they don't penalize the rest of the program. and in Perl 5.20, ${^PREMATCH}, ${^MATCH} and ${^POSTMATCH} are available whether the /p has been used or not (the modifier is just ignored), and $``, $'and$&` don't cause any speed difference at all. glow up ✨
💖 Non-capturing groupings 💖
a group that's only there to bundle a set of alternatives may or may not actually be useful as a capturing group. if it isn't, it just creates a superfluous addition to the set of available capture group values — inside and outside the regexp. rude. non-capturing groupings, denoted by (?:regexp), still let the regexp be treated as a single unit, but don't establish a capturing group at the same time. both capturing and non-capturing groupings are allowed to coexist in the same regexp. 💅
and because there's no extraction happening, non-capturing groupings are faster than capturing groupings. they're also handy for choosing exactly which parts of a regexp get extracted to matching variables:
# match a number, $1-$4 are set, but we only want $1
/([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
# match a number faster , only $1 is set
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
# match a number, get $1 = whole number, $2 = exponent
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;non-capturing groupings are also lowkey useful for removing nuisance elements gathered from a split operation where parentheses are required for some reason:
$x = '12aba34ba5';
@num = split /(a|b)+/, $x; # @num = ('12','a','34','a','5')
@num = split /(?:a|b)+/, $x; # @num = ('12','34','5')in Perl 5.22 and later, all groups within a regexp can be set to non-capturing by using the new /n flag:
"hello" =~ /(hi|hello)/n; # $1 is not set!(See "n" in perlre for more information.) 👑
🦋 Matching repetitions 🦋
so the examples in the previous section display an annoying weakness. we were only matching 3-letter words, or chunks of words of 4 letters or less. and we'd love to be able to match words — or, more generally, strings of any length — without writing out tedious alternatives like \w\w\w\w|\w\w\w|\w\w|\w. no one has time for that, fr fr. 😭
okay so THIS is literally the exact problem the quantifier metacharacters ?, *, +, and {} were invented to fix. 🎀 They let us say "yo, repeat this bit this many times" — they delimit the number of repeats for a portion of a regexp we consider to be a match. And quantifiers go immediately after the character, character class, or grouping we want to specify (like, right up on it, no space, bestie 🤝). Here's the whole menu of what they mean:
a?— matcha1 or 0 timesa*— matcha0 or more times, i.e., any number of timesa+— matcha1 or more times, i.e., at least oncea{n,m}— match at leastntimes, but not more thanmtimes.a{n,}— match at leastnor more timesa{,n}— match at mostntimes, or fewera{n}— match exactlyntimes
If you like (and honestly, live your truth ✨), you can add blanks (tab or space characters) within the braces, but adjacent to them, and/or next to the comma (if any).
Here are some examples:
/[a-z]+\s+\d*/; # match a lowercase word, at least one space, and
# any number of digits
/(\w+)\s+\g1/; # match doubled words of arbitrary length
/y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
$year =~ /^\d{2,4}$/; # make sure year is at least 2 but not more
# than 4 digits
$year =~ /^\d{ 2, 4 }$/; # Same; for those who like wide open
# spaces.
$year =~ /^\d{2, 4}$/; # Same.
$year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
$year =~ /^\d{2}(\d{2})?$/; # same thing written differently.
# However, this captures the last two
# digits in $1 and the other does not.
% simple_grep '^(\w+)\g1$' /usr/dict/words # isn't this easier?
beriberi
booboo
coco
mama
murmur
papaFor all of these quantifiers, Perl will try to match as much of the string as possible, while still allowing the regexp to succeed. So with /a?.../, Perl first tries to match the regexp with the a present; if that fails, Perl tries to match the regexp without the a present. For the quantifier *, we get this:
$x = "the cat in the hat";
$x =~ /^(.*)(cat)(.*)$/; # matches,
# $1 = 'the '
# $2 = 'cat'
# $3 = ' in the hat'Which is, like, what we'd expect — the match finds the only cat in the string and locks onto it. 💅 But now consider this regexp:
$x =~ /^(.*)(at)(.*)$/; # matches,
# $1 = 'the cat in the h'
# $2 = 'at'
# $3 = '' (0 characters match)Your first instinct might be that Perl would find the at in cat and stop there, but nope — that wouldn't give the longest possible string to the first quantifier .*. Instead, the first quantifier .* grabs as much of the string as possible while still having the regexp match. In this example, that means having the at sequence with the final at in the string. The other big principle illustrated here: when there are two or more elements in a regexp, the leftmost quantifier, if there is one, gets to grab as much of the string as possible, leaving the rest of the regexp to fight over scraps 😭. So in our example, the first quantifier .* grabs most of the string, while the second quantifier .* gets the empty string. Quantifiers that grab as much of the string as possible are called maximal match or greedy quantifiers.
When a regexp can match a string in several different ways, we can use the principles above to predict which way the regexp will match:
- Principle 0: Taken as a whole, any regexp will be matched at the earliest possible position in the string.
- Principle 1: In an alternation
a|b|c..., the leftmost alternative that allows a match for the whole regexp will be the one used. - Principle 2: The maximal matching quantifiers
?,*,+and{n,m}will in general match as much of the string as possible while still allowing the whole regexp to match. - Principle 3: If there are two or more elements in a regexp, the leftmost greedy quantifier, if any, will match as much of the string as possible while still allowing the whole regexp to match. The next leftmost greedy quantifier, if any, will try to match as much of the string remaining available to it as possible, while still allowing the whole regexp to match. And so on, until all the regexp elements are satisfied.
As we've seen above, Principle 0 overrides the others 👑. The regexp will be matched as early as possible, with the other principles determining how the regexp matches at that earliest character position.
Here's an example of these principles doing their thing:
$x = "The programming republic of Perl";
$x =~ /^(.+)(e|r)(.*)$/; # matches,
# $1 = 'The programming republic of Pe'
# $2 = 'r'
# $3 = 'l'This regexp matches at the earliest string position, T. You might think e, being leftmost in the alternation, would be the one matched — but r produces the longest string in the first quantifier. 🦋
$x =~ /(m{1,2})(.*)$/; # matches,
# $1 = 'mm'
# $2 = 'ing republic of Perl'Here the earliest possible match is at the first m in programming. m{1,2} is the first quantifier, so it gets to match a maximal mm.
$x =~ /.*(m{1,2})(.*)$/; # matches,
# $1 = 'm'
# $2 = 'ing republic of Perl'Here the regexp matches at the start of the string. The first quantifier .* grabs as much as possible, leaving just a single m for the second quantifier m{1,2}.
$x =~ /(.?)(m{1,2})(.*)$/; # matches,
# $1 = 'a'
# $2 = 'mm'
# $3 = 'ing republic of Perl'Here .? eats its maximal one character at the earliest possible position in the string, a in programming, leaving m{1,2} the opportunity to match both m's. And finally:
"aXXXb" =~ /(X*)/; # matches with $1 = ''because it can match zero copies of X at the beginning of the string. If you definitely want to match at least one X, use X+, not X*. (not me learning this the hard way 🙈)
Sometimes greed is not good. At times, we'd like quantifiers to match a minimal piece of string, rather than a maximal piece. For this purpose, Larry Wall created the minimal match or non-greedy quantifiers ??, *?, +?, and {}?. These are just the usual quantifiers with a ? appended to them 🫶. They mean:
a??— matcha0 or 1 times. Try 0 first, then 1.a*?— matcha0 or more times, i.e., any number of times, but as few times as possiblea+?— matcha1 or more times, i.e., at least once, but as few times as possiblea{n,m}?— match at leastntimes, not more thanmtimes, as few times as possiblea{n,}?— match at leastntimes, but as few times as possiblea{,n}?— match at mostntimes, but as few times as possiblea{n}?— match exactlyntimes. Because we match exactlyntimes,a{n}?is equivalent toa{n}and is just there for notational consistency.
Let's look at the example above, but with minimal quantifiers:
$x = "The programming republic of Perl";
$x =~ /^(.+?)(e|r)(.*)$/; # matches,
# $1 = 'Th'
# $2 = 'e'
# $3 = ' programming republic of Perl'The minimal string that will allow both the start of the string ^ and the alternation to match is Th, with the alternation e|r matching e. And the second quantifier .* is free to gobble up the rest of the string 😋.
$x =~ /(m{1,2}?)(.*?)$/; # matches,
# $1 = 'm'
# $2 = 'ming republic of Perl'The first string position that this regexp can match is at the first m in programming. At this position, the minimal m{1,2}? matches just one m. Although the second quantifier .*? would prefer to match no characters, it's constrained by the end-of-string anchor $ to match the rest of the string.
$x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
# $1 = 'The progra'
# $2 = 'm'
# $3 = 'ming republic of Perl'In this regexp you might expect the first minimal quantifier .*? to match the empty string, because it's not constrained by a ^ anchor to match the beginning of the word. But Principle 0 applies here, bestie. Because it's possible for the whole regexp to match at the start of the string, it will match at the start of the string. So the first quantifier has to match everything up to the first m. The second minimal quantifier matches just one m, and the third quantifier matches the rest of the string.
$x =~ /(.??)(m{1,2})(.*)$/; # matches,
# $1 = 'a'
# $2 = 'mm'
# $3 = 'ing republic of Perl'Just like in the previous regexp, the first quantifier .?? can match earliest at position a, so it does. The second quantifier is greedy, so it matches mm, and the third matches the rest of the string.
We can modify Principle 3 above to take non-greedy quantifiers into account:
- Principle 3: If there are two or more elements in a regexp, the leftmost greedy (non-greedy) quantifier, if any, will match as much (little) of the string as possible while still allowing the whole regexp to match. The next leftmost greedy (non-greedy) quantifier, if any, will try to match as much (little) of the string remaining available to it as possible, while still allowing the whole regexp to match. And so on, until all the regexp elements are satisfied.
Just like alternation, quantifiers are also susceptible to backtracking. 💀 Here's a step-by-step analysis of the example
$x = "the cat in the hat";
$x =~ /^(.*)(at)(.*)$/; # matches,
# $1 = 'the cat in the h'
# $2 = 'at'
# $3 = '' (0 matches)- Start with the first letter in the string
t. - so the first quantifier
.*starts out by matching the whole string"the cat in the hat". icon behavior honestly 💅 - then
ain the regexp elementatdoesn't match the end of the string. backtrack one character. sad. 😭 ain the regexp elementatstill doesn't match that last letter of the string,t, so we backtrack one more character. the drama fr.- okay NOW we can match the
aand thet. slay ✨ - move on to the third element,
.*. since we're at the end of the string and.*can match 0 times, it just gets assigned the empty string. it's giving minimal effort, iconic 🎀 - and we're done!! 👑
Most of the time all this moving forward and backtracking happens hella fast and searching is quick. BUT — there are some pathological regexps out there whose execution time exponentially grows with the size of the string. 💀 a typical structure that blows up in your face is of the form
/(a|b+)*/;the problem is the nested indeterminate quantifiers. there are so many different ways of partitioning a string of length n between the + and the *: one repetition with b+ of length n, two repetitions with the first b+ length k and the second with length n-k, m repetitions whose bits add up to length n, etc. like, there are literally an exponential number of ways to partition a string as a function of its length. a regexp might get lucky and match early in the process, but if there's no match, Perl will try every possibility before giving up. so bestie, be careful with nested *'s, {n,m}'s, and +'s. 🫶 the book Mastering Regular Expressions by Jeffrey Friedl gives a wonderful discussion of this and other efficiency issues.
🌸 Possessive quantifiers 🌸
backtracking during the relentless search for a match may be a waste of time, especially when the match is bound to fail. consider the simple pattern
/^\w+\s+\w+$/; # a word, spaces, a wordwhenever this gets applied to a string which doesn't quite meet the pattern's expectations — like "abc " or "abc def " — the regexp engine will backtrack, approximately once for each character in the string. but we know there's no way around taking all of the initial word characters to match that first repetition, that all spaces must be eaten by the middle part, and same goes for the second word. so why are we doing all this work 🙈
with the introduction of the possessive quantifiers in Perl 5.10, we finally have a way to tell the regexp engine not to backtrack — it's the usual quantifiers with a + appended to them. this makes them greedy as well as stingy; once they succeed they won't give anything back to permit another solution. no take-backsies, no cap. they have the following meanings:
"a{n,m}+"means: match at leastntimes, not more thanmtimes, as many times as possible, and don't give anything up."a?+"is short for"a{0,1}+""a{n,}+"means: match at leastntimes, but as many times as possible, and don't give anything up."a++"is short for"a{1,}+"."a{,n}+"means: match as many times as possible up to at mostntimes, and don't give anything up."a*+"is short for"a{0,}+"."a{n}+"means: match exactlyntimes. it's just there for notational consistency. (it's giving consistency, we respect it 💅)
these possessive quantifiers represent a special case of a more general concept, the independent subexpression — see below.
as an example where a possessive quantifier is suitable, let's consider matching a quoted string, as it appears in several programming languages. the backslash is used as an escape character that says the next character is to be taken literally, as another character for the string. therefore, after the opening quote, we expect a (possibly empty) sequence of alternatives: either some character except an unescaped quote or backslash, or an escaped character. so:
/"(?:[^"\\]++|\\.)*+"/;🌈 Building a regexp 🌈
okay at this point we have all the basic regexp concepts covered, so let's do a more involved example. bestie, we're gonna build a regexp that matches numbers. 👑
the first task in building a regexp is deciding what we want to match and what we want to exclude. in our case, we want to match both integers and floating point numbers, and we want to reject any string that isn't a number. periodt.
the next task is breaking the problem down into smaller problems that are easily converted into a regexp.
the simplest case is integers. these consist of a sequence of digits, with an optional sign in front. the digits we can represent with "\d+" and the sign can be matched with "[+-]". so the integer regexp is
/[+-]?\d+/; # matches integersa floating point number potentially has a sign, an integral part, a decimal point, a fractional part, and an exponent. one or more of these parts is optional, so we need to check out the different possibilities. floating point numbers which are in proper form include 123., 0.345, .34, -1e6, and 25.4E-72. as with integers, the sign out front is completely optional and can be matched by "[+-]?". we can see that if there's no exponent, floating point numbers must have a decimal point — otherwise they're integers. we might be tempted to model these with "\d*\.\d*", but that would also match just a single decimal point, which is not a number. so the three cases of floating point number without exponent are
/[+-]?\d+\./; # 1., 321., etc.
/[+-]?\.\d+/; # .1, .234, etc.
/[+-]?\d+\.\d+/; # 1.0, 30.56, etc.these can be combined into a single regexp with a three-way alternation:
/[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponentin this alternation, it is important to put '\d+\.\d+' before '\d+\.'. if '\d+\.' were first, the regexp would happily match that and ignore the fractional part of the number. order matters bestie, don't play yourself 😭
now consider floating point numbers with exponents. the key observation here is that both integers and numbers with decimal points are allowed in front of an exponent. then exponents, like the overall sign, are independent of whether we're matching numbers with or without decimal points, and can be "decoupled" from the mantissa. the overall form of the regexp now becomes clear:
/^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;the exponent is an 'e' or 'E', followed by an integer. so the exponent regexp is
/[eE][+-]?\d+/; # exponentputting all the parts together, we get a regexp that matches numbers:
/^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!long regexps like this may impress your friends, but they can be hard to decipher. ✨ in complex situations like this, the "/x" modifier for a match is invaluable. it lets you put nearly arbitrary whitespace and comments into a regexp without affecting their meaning. using it, we can rewrite our "extended" regexp in the more pleasing form
/^
[+-]? # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+\.\d+ # mantissa of the form a.b
|\d+\. # mantissa of the form a.
|\.\d+ # mantissa of the form .b
|\d+ # integer of the form a
)
( [eE] [+-]? \d+ )? # finally, optionally match an exponent
$/x;so if whitespace is mostly irrelevant, how does one include space characters in an extended regexp? 🤔 the answer is to backslash it '\ ' or put it in a character class "[ ]". same thing goes for pound signs: use "\#" or "[#]". for instance, Perl allows a space between the sign and the mantissa or integer, and we could add this to our regexp as follows:
/^
[+-]?\ * # first, match an optional sign *and space*
( # then match integers or f.p. mantissas:
\d+\.\d+ # mantissa of the form a.b
|\d+\. # mantissa of the form a.
|\.\d+ # mantissa of the form .b
|\d+ # integer of the form a
)
( [eE] [+-]? \d+ )? # finally, optionally match an exponent
$/x;in this form, it's easier to see a way to simplify the alternation. alternatives 1, 2, and 4 all start with "\d+", so it could be factored out:
/^
[+-]?\ * # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+ # start out with a ...
(
\.\d* # mantissa of the form a.b or a.
)? # ? takes care of integers of the form a
|\.\d+ # mantissa of the form .b
)
( [eE] [+-]? \d+ )? # finally, optionally match an exponent
$/x;starting in Perl v5.26, specifying "/xx" changes the square-bracketed portions of a pattern to ignore tabs and space characters unless they're escaped by preceding them with a backslash. so we could write
/^
[ + - ]?\ * # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+ # start out with a ...
(
\.\d* # mantissa of the form a.b or a.
)? # ? takes care of integers of the form a
|\.\d+ # mantissa of the form .b
)
( [ e E ] [ + - ]? \d+ )? # finally, optionally match an exponent
$/xx;this doesn't really improve the legibility of this example, but it's available in case you want it. honestly, whatever works for you bestie 🫶 squashing the pattern down to the compact form, we have
/^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;this is our final regexp. 🎀 to recap, we built a regexp by
- specifying the task in detail,
- breaking down the problem into smaller parts,
- translating the small parts into regexps,
- combining the regexps,
- and optimizing the final combined regexp.
these are also the typical steps involved in writing a computer program. which makes perfect sense, because regular expressions are essentially programs written in a little computer language that specifies patterns. no cap. 💜
🌟 Using regular expressions in Perl 🌟
the last topic of Part 1 briefly covers how regexps are used in Perl programs. where do they even fit into Perl syntax? 🤔
we've already introduced the matching operator in its default "/regexp/" form and its arbitrary delimiter "m!regexp!" form. we've used the binding operator "=~" and its negation "!~" to test for string matches. and associated with the matching operator, we've discussed the single line "/s", multi-line "/m", case-insensitive "/i" and extended "/x" modifiers. there are a few more things you might want to know about matching operators though. 👀
🎀 Prohibiting substitution 🎀
if you change $pattern after the first substitution happens, Perl will ignore it. if you don't want any substitutions at all, use the special delimiter "m''":
@pattern = ('Seuss');
while (<>) {
print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
}okay so bestie, strings have been through it, and now the m'' thing: if you write m'' it acts like apostrophes on a regexp, meaning no variable interpolation, while literally every other m delimiter acts like quotes. And yes, if the regexp evaluates to the empty string, the regexp from the last successful match gets used instead. So:
"dog" =~ /d/; # 'd' matches
"dogbert" =~ //; # this matches the 'd' regexp used beforeBestie. That's a whole vibe. 🌸
✨ Global matching ✨
The last two modifiers we're talking about here, /g and /c, are all about multiple matches. The /g modifier stands for global matching, and it lets the matching operator match within a string as many times as it possibly can. In scalar context, invoking it again and again against a string makes /g jump from match to match, keeping track of its position in the string as it goes. You can grab or set that position with the pos() function. 💅
Using /g looks like this. Say we've got a string made of words separated by spaces. If we already know how many words there are, we could pull them out with groupings:
$x = "cat dog house"; # 3 words
$x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
# $1 = 'cat'
# $2 = 'dog'
# $3 = 'house'But what if we have an indeterminate number of words? This is literally the exact task /g was made for. To extract all the words, form the simple regexp (\w+) and loop over all matches with /(\w+)/g:
while ($x =~ /(\w+)/g) {
print "Word is $1, ends at position ", pos $x, "\n";
}which prints
Word is cat, ends at position 3
Word is dog, ends at position 7
Word is house, ends at position 13A failed match, or changing the target string, resets the position. If you don't want the position reset after a failed match, add the /c, like /regexp/gc. Important: the current position in the string is tied to the string, not the regexp. Which means different strings have different positions, and each one's position can be set or read independently. 🦋
In list context, /g returns a list of the matched groupings — or, if there are no groupings, a list of matches to the whole regexp. So if we only wanted the words, we could do:
@words = ($x =~ /(\w+)/g); # matches,
# $words[0] = 'cat'
# $words[1] = 'dog'
# $words[2] = 'house'Super closely associated with the /g modifier is the \G anchor. The \G anchor matches at the point where the previous /g match left off. \G lets us do context-sensitive matching with zero struggle:
$metric = 1; # use metric units
...
$x = <FILE>; # read in measurement
$x =~ /^([+-]?\d+)\s*/g; # get magnitude
$weight = $1;
if ($metric) { # error checking
print "Units error!" unless $x =~ /\Gkg\./g;
}
else {
print "Units error!" unless $x =~ /\Glbs\./g;
}
$x =~ /\G\s+(widget|sprocket)/g; # continue processingThe combo of /g and \G lets us process the string a little at a time and use arbitrary Perl logic to decide what to do next. Iconic behavior, honestly. ✨
\G is also invaluable for processing fixed-length records with regexps. Say we have a snippet of coding region DNA, encoded as base pair letters ATCGTTGAAT... and we want to find all the stop codons TGA. In a coding region, codons are 3-letter sequences, so we can think of the DNA snippet as a sequence of 3-letter records. The naive regexp:
# expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
$dna = "ATCGTTGAATGCAAATGACATGAC";
$dna =~ /TGA/;does not work. It may match a TGA, but there's no guarantee that the match is aligned with codon boundaries — like, the substring GTT GAA gives a match. So not it. A better solution is:
while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
print "Got a TGA stop codon at position ", pos $dna, "\n";
}which prints
Got a TGA stop codon at position 18
Got a TGA stop codon at position 23Position 18 is good, but position 23 is bogus. What happened?? 😭
The answer: our regexp works great until we get past the last real match. Then the regexp fails to match a synchronized TGA and starts stepping ahead one character position at a time, which is not what we want at all. The solution is to use \G to anchor the match to the codon alignment:
while ($dna =~ /\G(\w\w\w)*?TGA/g) {
print "Got a TGA stop codon at position ", pos $dna, "\n";
}This prints
Got a TGA stop codon at position 18which is the correct answer. 👑 This example illustrates that it's important not only to match what is desired, but to reject what is not desired. Periodt.
(There are other regexp modifiers that are available, such as /o, but their specialized uses are beyond the scope of this introduction. )
✨ Search and replace ✨
Regular expressions also play a big role in search and replace operations in Perl. Search and replace is accomplished with the s/// operator. The general form is s/regexp/replacement/modifiers, with everything we know about regexps and modifiers applying here too. The replacement is a Perl double-quoted string that replaces in the string whatever is matched with the regexp. The operator =~ is also used here to associate a string with s///. If you're matching against $_, the $_ =~ can be dropped. If there's a match, s/// returns the number of substitutions made; otherwise it returns false. Here are a few examples:
$x = "Time to feed the cat!";
$x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
$more_insistent = 1;
}
$y = "'quoted words'";
$y =~ s/^'(.*)'$/$1/; # strip single quotes,
# $y contains "quoted words"In that last example, the whole string was matched, but only the part inside the single quotes was grouped. With the s/// operator, the matched variables $1, $2, etc. are immediately available for use in the replacement expression, so we use $1 to replace the quoted string with just what was quoted. With the global modifier, s///g will search and replace all occurrences of the regexp in the string:
$x = "I batted 4 for 4";
$x =~ s/4/four/; # doesn't do it all:
# $x contains "I batted four for 4"
$x = "I batted 4 for 4";
$x =~ s/4/four/g; # does it all:
# $x contains "I batted four for four"If you prefer regex over regexp in this tutorial, you could use the following program to replace it:
% cat > simple_replace
#!/usr/bin/perl
$regexp = shift;
$replacement = shift;
while (<>) {
s/$regexp/$replacement/g;
print;
}
^D
% simple_replace regexp regex perlretut.podIn simple_replace we used the s///g modifier to replace all occurrences of the regexp on each line. (Even though the regular expression appears in a loop, Perl is smart enough to compile it only once.) Just like with simple_grep, both the print and the s/$regexp/$replacement/g use $_ implicitly. 🫶
If you don't want s/// to change your original variable, you can use the non-destructive substitute modifier, s///r. This changes the behavior so that s///r returns the final substituted string (instead of the number of substitutions):
$x = "I like dogs.";
$y = $x =~ s/dogs/cats/r;
print "$x $y\n";That example will print "I like dogs. I like cats". Notice the original $x variable has not been affected — the overall result of the substitution is instead stored in $y. And if the substitution doesn't affect anything, then the original string is returned:
$x = "I like dogs.";
$y = $x =~ s/elephants/cougars/r;
print "$x $y\n"; # prints "I like dogs. I like dogs."One other interesting thing that the s///r flag allows is chaining substitutions:
$x = "Cats are great.";
print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~
s/Frogs/Hedgehogs/r, "\n";
# prints "Hedgehogs are great."A modifier available specifically to search and replace is the s///e evaluation modifier. s///e treats the replacement text as Perl code, rather than a double-quoted string. The value that the code returns is substituted for the matched substring. s///e is useful if you need to do a bit of computation in the process of replacing text. This example counts character frequencies in a line:
$x = "Bill the cat";
$x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
print "frequency of '$_' is $chars{$_}\n"
foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);This prints
frequency of ' ' is 2
frequency of 't' is 2
frequency of 'l' is 2
frequency of 'B' is 1
frequency of 'c' is 1
frequency of 'e' is 1
frequency of 'h' is 1
frequency of 'i' is 1
frequency of 'a' is 1Just like with the match m// operator, s/// can use other delimiters, such as s!!! and s{}{}, and even s{}//. If single quotes are used, s''', then the regexp and replacement are treated as single-quoted strings and there are no variable substitutions. And s/// in list context returns the same thing as in scalar context, i.e., the number of matches. 💅
✨ The split function ✨
The split() function is another place where a regexp is used. split /regexp/, string, limit separates the string operand into a list of substrings and returns that list. The regexp must be designed to match whatever constitutes the separators for the desired substrings. The limit, if present, constrains splitting into no more than limit number of strings. For example, to split a string into words, use:
$x = "Calvin and Hobbes";
@words = split /\s+/, $x; # $word[0] = 'Calvin'
# $word[1] = 'and'
# $word[2] = 'Hobbes'If the empty regexp // is used, the regexp always matches and the string is split into individual characters. If the regexp has groupings, then the resulting list contains the matched substrings from the groupings as well. For instance,
$x = "/usr/bin/perl";
@dirs = split m!/!, $x; # $dirs[0] = ''
# $dirs[1] = 'usr'
# $dirs[2] = 'bin'
# $dirs[3] = 'perl'
@parts = split m!(/)!, $x; # $parts[0] = ''
# $parts[1] = '/'
# $parts[2] = 'usr'
# $parts[3] = '/'
# $parts[4] = 'bin'
# $parts[5] = '/'
# $parts[6] = 'perl'And why did the first slot come out empty bestie?? Because the very first character of $x matched the regexp, so split was like "okay, here's an empty initial element for u" and prepended it to the list. 💅 It's giving "participation trophy for the empty string" honestly.
omg okay. If you've read all the way to this point: congratulations!! 🎉👑 You now officially have all the basic tools needed to use regular expressions to solve a wide range of text processing problems. That's not nothing, that's a whole skill tree unlocked.
And if this is your first time through the tutorial? Bestie, seriously: stop here and go play around with regexps for a while. Like actually go do it. 🌸 Part 2 is about the more esoteric aspects of regular expressions, and honestly those concepts are not needed right at the start</>. No cap. Take the win, go experiment, come back when you're hungry for more.
✨ Part 2: Power tools ✨
OK so. You know the basics of regexps and you want more. Respect. 🫶
Here's the vibe check: if matching regular expressions is like a walk in the woods, then the tools from Part 1 are your topo maps and your compass — the basic stuff you use literally all the time. Most of the tools in Part 2? Those are the flare guns and the satellite phones. 📡🔥 You don't carry them on every cute little hike. But when you're stuck out there, they are invaluable and you're gonna be so glad you know them.
What's coming up: the more advanced, less-used, and sometimes straight-up esoteric capabilities of Perl regexps. In Part 2 we're assuming you're comfy with the basics, so we're going to concentrate on the advanced features. 🧚✨
🦋 More on characters, strings, and character classes 🦋
There are a whole bunch of escape sequences and character classes we haven't covered yet. Sit down, get comfy, this is the good part.
There are several escape sequences that convert characters or strings between upper and lower case, and — plot twist — they also work inside patterns. "\l" and "\u" convert the next character to lower or upper case, respectively:
$x = "perl";
$string =~ /\u$x/; # matches 'Perl' in $string
$x = "M(rs?|s)\\."; # note the double backslash
$string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',A "\L" or "\U" means the case conversion keeps going — a lasting conversion — all the way until it's terminated by "\E" or thrown over by another "\U" or "\L":
$x = "This word is in lower case:\L SHOUT\E";
$x =~ /shout/; # matches
$x = "I STILL KEYPUNCH CARDS FOR MY 360";
$x =~ /\Ukeypunch/; # matches punch card stringIf there's no "\E"? Then case conversion just keeps going until the end of the string. Feral behavior honestly, but iconic. 😭
The regexps "\L\u$word" or "\u\L$word" convert the first character of $word to uppercase and the rest of the characters to lowercase. (Heads up tho: beyond ASCII characters it gets somewhat more complicated — "\u" actually performs titlecase mapping, which for most characters is the same as uppercase, but not for all. See <https://unicode.org/faq/casemap_charprop.html#4>.)
Control characters can be escaped with "\c", so a control-Z character would be matched with "\cZ". 💀
The escape sequence "\Q"..."\E" quotes, or protects, most non-alphabetic characters. Like so:
$x = "\QThat !^*&%~& cat!";
$x =~ /\Q!^*&%~&\E/; # check for rough language⚠️ But it does not protect '$' or '@', so that variables can still be substituted. Important detail, don't forget it.
Now, a real one: "\Q", "\L", "\l", "\U", "\u" and "\E" are actually part of double-quotish syntax, and not part of regexp syntax proper. They'll work if they appear in a regular expression embedded directly in a program — but not when contained in a string that is interpolated in a pattern. Yeah. That's a thing. Write that down. 📝
Perl regexps can handle more than just the standard ASCII character set, and this is where it gets beautiful. Perl supports Unicode — a standard for representing the alphabets from virtually all of the world's written languages, plus a host of symbols. Perl's text strings are Unicode strings, so they can contain characters with a value (codepoint or character number) higher than 255. ✨
So what does this mean for regexps? Well, regexp users don't need to know much about Perl's internal representation of strings. But they do need to know two things:
- how to represent Unicode characters in a regexp, and
- that a matching operation will treat the string to be searched as a sequence of characters, not bytes.
The answer to 1) is that Unicode characters greater than chr(255) are represented using the "\x{hex}" notation, because "\x"XY (specified as two hex digits without curly braces) doesn't go further than 255. (Starting in Perl 5.14, if you're an octal fan, you can also use "\o{oct}".)
/\x{263a}/; # match a Unicode smiley face :)
/\x{ 263a }/; # SameNOTE: In Perl 5.6.0 it used to be that one needed to sayuse utf8to use any Unicode features. This is no longer the case: for almost all Unicode processing, the explicitutf8pragma is not needed. (The only case where it matters is if your Perl script is in Unicode and encoded in UTF-8, then an explicituse utf8is needed.)
Figuring out the hexadecimal sequence of a Unicode character you want — or deciphering somebody else's hexadecimal Unicode regexp — is about as much fun as programming in machine code. 💀 Which is not very much fun. So, alternative: you can specify Unicode characters with the named character escape sequence "\N{name}". Here name is a name for the Unicode character, as specified in the Unicode standard. For instance, if we wanted to represent or match the astrological sign for the planet Mercury, we could use:
$x = "abc\N{MERCURY}def";
$x =~ /\N{MERCURY}/; # matches
$x =~ /\N{ MERCURY }/; # Also matchesOne can also use "short" names:
print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
print "\N{greek:Sigma} is an upper-case sigma.\n";And you can restrict names to a certain alphabet by specifying the charnames pragma:
use charnames qw(greek);
print "\N{sigma} is Greek sigma\n";An index of character names is available on-line from the Unicode Consortium, <https://www.unicode.org/charts/charindex.html>; explanatory material with links to other resources lives at <https://www.unicode.org/standard/where>.
Starting in Perl v5.32, there's an alternative to "\N{...}" for full names, and that is to say:
/\p{Name=greek small letter sigma}/The casing of the character name is irrelevant when used in "\p{}", and so are most spaces, underscores and hyphens. (A few outlier characters cause problems with ignoring all of them always. The details — which you can look up when you get more proficient, and if ever needed — are in <https://www.unicode.org/reports/tr44/tr44-24.html#UAX44-LM2>.)
The answer to requirement 2) is that a regexp (mostly) uses Unicode characters. The "mostly" is there for messy backward compatibility reasons 🌪️ — but starting in Perl 5.14, any regexp compiled in the scope of a use feature 'unicode_strings' (which is automatically turned on within the scope of a use v5.12 or higher) will turn that "mostly" into "always". So if you want to handle Unicode properly, you should ensure that 'unicode_strings' is turned on. 🫶
Internally, this is encoded to bytes using either UTF-8 or a native 8 bit encoding, depending on the history of the string — but conceptually it is a sequence of characters, not bytes. See perlunitut for a tutorial about that.
Let us now discuss Unicode character classes, most usually called "character properties". These are represented by the "\p{name}" escape sequence. The negation of this is "\P{name}". For example, to match lower and uppercase characters:
$x = "BOB";
$x =~ /^\p{IsUpper}/; # matches, uppercase char class
$x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
$x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
$x =~ /^\P{IsLower}/; # matches, char class sans lowercase(The ""Is"" is optional. Slay.)
There are many, many Unicode character properties. For the full list, see perluniprops. Most of them have synonyms with shorter names, also listed there. Some synonyms are a single character — and for those you can drop the braces. For instance, "\pM" is the same thing as "\p{Mark}", meaning things like accent marks. 💅
The Unicode "\p{Script}" and "\p{Script_Extensions}" properties are used to categorize every Unicode character into the language script it's written in. For example, English, French, and a bunch of other European languages are written in the Latin script. But there's also the Greek script, the Thai script, the Katakana script, etc. ("Script" is an older, less advanced form of "Script_Extensions", retained only for backwards compatibility.) You can test whether a character is in a particular script with, for example, "\p{Latin}", "\p{Greek}", or "\p{Katakana}". To test if it isn't in the Balinese script, you'd use "\P{Balinese}". (These all use "Script_Extensions" under the hood, because that gives better results. 👑)
What we've described so far is the single form of the "\p{...}" character classes. There's also a compound form which you may run into. These look like "\p{name=value}" or "\p{name:value}" — the equals sign and colon can be used interchangeably. These are more general than the single form, and in fact most of the single forms are just Perl-defined shortcuts for common compound forms. For example, the script examples in the previous paragraph could be written equivalently as "\p{Script_Extensions=Latin}", "\p{Script_Extensions:Greek}", "\p{script_extensions=katakana}", and "\P{script_extensions=balinese}" (case is irrelevant between the "{}" braces).
You may never have to use the compound forms — but sometimes it's necessary, and honestly their use can make your code easier to understand. Readable code is the moment. ✨
"\X" is an abbreviation for a character class that comprises a Unicode extended grapheme cluster. This represents a "logical character": what appears to be a single character, but may be represented internally by more than one. As an example, using the Unicode full names, e.g., "A + COMBINING RING" is a grapheme cluster with base character "A" and combining character "COMBINING RING, which translates in Danish to "A" with the circle atop it, as in the word Ångstrom. 🎀
For the full and latest information about Unicode, see the latest Unicode standard, or the Unicode Consortium's website <https://www.unicode.org>.
Okay so if ALL those classes weren't already a whole buffet, Perl also defines POSIX-style character classes 💅 They look like [:name:], where name is the name of the POSIX class. The full roster: alpha, alnum, ascii, blank, cntrl, digit, graph, lower, print, punct, space, upper, xdigit, and word (that last one is a Perl extension that matches \w, iykyk 🦋).
The /a modifier keeps these locked to the ASCII range only; otherwise they can match the same stuff as their corresponding Perl Unicode classes, so like [:upper:] is literally the same as \p{IsUpper}, etc. (heads up tho — there are some exceptions and gotchas with this, peep perlrecharclass for the full tea ☕). Also [:digit:], [:word:], and [:space:] line up with the familiar \d, \w, and \s character classes. Wanna negate a POSIX class? Just slap a ^ in front of the name, so for example [:^digit:] corresponds to \D and, under Unicode, \P{IsDigit} ✨
You use Unicode and POSIX character classes just like \d, with ONE exception: POSIX character classes can only go inside a character class. Rude but okay:
/\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
/^=item\s[[:digit:]]/; # match '=item',
# followed by a space and a digit
/\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
/^=item\s\p{IsDigit}/; # match '=item',
# followed by a space and a digitWhew! That is all the rest of the characters and character classes 🫶
🎀 Compiling and saving regular expressions
Back in Part 1 we mentioned that Perl compiles a regexp into a compact sequence of opcodes 👑 Which means a compiled regexp is a data structure you can store once and then use again and again. And that is exactly what the regexp quote qr// does: qr/string/ compiles the string as a regexp and transforms the result into a form you can assign to a variable:
$reg = qr/foo+bar?/; # reg contains a compiled regexpThen $reg can be used as a regexp, no biggie:
$x = "fooooba";
$x =~ $reg; # matches, just like /foo+bar?/
$x =~ /$reg/; # same thing, alternate formAnd $reg can also be interpolated into a bigger regexp:
$x =~ /(abc)?$reg/; # still matchesJust like with the matching operator, the regexp quote can use different delimiters, e.g. qr!!, qr{} or qr~~. Apostrophes as delimiters (qr'') inhibit any interpolation 🚫
Pre-compiled regexps are so useful for creating dynamic matches that don't need to be recompiled every single time they're encountered. Using pre-compiled regexps, we write a grep_step program which greps for a sequence of patterns, advancing to the next pattern as soon as one has been satisfied. Iconic behaviour, honestly:
% cat > grep_step
#!/usr/bin/perl
# grep_step - match <number> regexps, one after the other
# usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
@compiled = map qr/$_/, @regexp;
while ($line = <>) {
if ($line =~ /$compiled[0]/) {
print $line;
shift @compiled;
last unless @compiled;
}
}
^D% grep_step 3 shift print last grep_step
$number = shift;
print $line;
last unless @compiled;Storing pre-compiled regexps in an array @compiled lets us just loop through the regexps with zero recompilation, so we gain flexibility without sacrificing speed 💖 it's giving efficiency, it's giving main character energy.
🌸 Composing regular expressions at runtime
Backtracking is more efficient than doing repeated tries with different regular expressions. So if you've got several regular expressions and a match with any of them is acceptable, you can combine them into a set of alternatives. And if the individual expressions are input data, you can pull this off by programming a join operation 🔥 We'll exploit this idea in a glow-up version of the simple_grep program: a program that matches multiple patterns:
% cat > multi_grep
#!/usr/bin/perl
# multi_grep - match any of <number> regexps
# usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
$pattern = join '|', @regexp;
while ($line = <>) {
print $line if $line =~ /$pattern/;
}
^D% multi_grep 2 shift for multi_grep
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);Sometimes it's actually advantageous to construct a pattern from the input that is to be analyzed, and use the permissible values on the left hand side of the matching operations 🤯 For an example of this slightly paradoxical situation, let's assume our input contains a command verb which should match one out of a set of available command verbs, with the extra twist that commands may be abbreviated as long as the given string is unique. The program below demonstrates the basic algorithm:
% cat > keymatch
#!/usr/bin/perl
$kwds = 'copy compare list print';
while( $cmd = <> ){
$cmd =~ s/^\s+|\s+$//g; # trim leading and trailing spaces
if( ( @matches = $kwds =~ /\b$cmd\w*/g ) == 1 ){
print "command: '@matches'\n";
} elsif( @matches == 0 ){
print "no such command: '$cmd'\n";
} else {
print "not unique: '$cmd' (could be one of: @matches)\n";
}
}
^D% keymatch
li
command: 'list'
co
not unique: 'co' (could be one of: copy compare)
printer
no such command: 'printer'So instead of trying to match the input against the keywords, we match the combined set of keywords against the input. The pattern matching operation $kwds =~ /\b($cmd\w*)/g does several things at the same time 👑 It makes sure the given command begins where a keyword begins (\b). It tolerates abbreviations thanks to the added \w*. And it tells us the number of matches (scalar @matches) plus all the keywords that were actually matched. You could hardly ask for more, fr fr.
💅 Embedding comments and modifiers in a regular expression
Starting with this section, we're getting into Perl's set of extended patterns ✨ These are extensions to the traditional regular expression syntax that hand you powerful new tools for pattern matching. We've already seen extensions in the form of the minimal matching constructs ??, *?, +?, {n,m}?, {n,}?, and {,n}?. Most of the extensions below take the form (?char...), where the char is a character that determines the type of extension.
The first extension is an embedded comment (?#text). This embeds a comment right into the regular expression without messing with its meaning 🎀 The comment should not have any closing parentheses in the text. Example:
/(?# Match an integer:)[+-]?\d+/;Ngl this style of commenting has been largely superseded by the raw, freeform commenting that's allowed with the /x modifier.
Most modifiers, like /i, /m, /s and /x (or any combination of them), can also be embedded in a regexp using (?i), (?m), (?s), and (?x). For instance:
/(?i)yes/; # match 'yes' case insensitively
/yes/i; # same thing
/(?x)( # freeform version of an integer regexp
[+-]? # match an optional sign
\d+ # match a sequence of digits
)
/x;Embedded modifiers have two important advantages over the usual modifiers. First: embedded modifiers allow a custom set of modifiers for each regexp pattern. Which is great for matching an array of regexps that must have different modifiers:
$pattern[0] = '(?i)doctor';
$pattern[1] = 'Johnson';
...
while (<>) {
foreach $patt (@pattern) {
print if /$patt/;
}
}The second advantage: embedded modifiers (except /p, which modifies the entire regexp) only affect the regexp inside the group the embedded modifier is contained in 🦋 So grouping can be used to localize the modifier's effects:
/Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.Embedded modifiers can also turn off any modifiers already present by using, e.g., (?-i). And modifiers can be combined into a single expression, e.g. (?s-i) turns on single line mode and turns off case insensitivity.
Embedded modifiers may also be added to a non-capturing grouping. (?i-m:regexp) is a non-capturing grouping that matches regexp case insensitively and turns off multi-line mode 🌈
🧚 Looking ahead and looking behind
This section is all about the lookahead and lookbehind assertions. First, a little background 💜
In Perl regular expressions, most regexp elements "eat up" a certain amount of string when they match. For instance, the regexp element [abc] eats up one character of the string when it matches, in the sense that Perl moves to the next character position in the string after the match. There are some elements, however, that don't eat up characters (advance the character position) if they match. The examples we've seen so far are the anchors. The anchor ^ matches the beginning of the line, but doesn't eat any characters. Similarly, the word boundary anchor \b matches wherever a character matching \w is next to a character that doesn't, but it doesn't eat up any characters itself 💀
Anchors are examples of zero-width assertions: zero-width because they consume no characters, and assertions because they test some property of the string. In the context of our walk in the woods analogy to regexp matching, most regexp elements move us along a trail, but anchors have us stop a moment and check our surroundings 🌲 If the local environment checks out, we can proceed forward. But if the local environment doesn't satisfy us, we must backtrack.
Checking the environment entails either looking 👀 ahead on the trail, looking behind, or both. ^ looks behind, to see that there are no characters before. $ looks ahead, to see that there are no characters after. \b looks both ahead and behind, to see if the characters on either side differ in their "word-ness".
The lookahead and lookbehind assertions are generalizations of the anchor concept 🫶 Lookahead and lookbehind are zero-width assertions that let us specify which characters we want to test for. The lookahead assertion is denoted by (?=regexp) or (starting in 5.32, experimentally in 5.28) (*pla:regexp) or (*positive_lookahead:regexp); and the lookbehind assertion is denoted by (?<=fixed-regexp) or (starting in 5.32, experimentally in 5.28) (*plb:fixed-regexp) or (*positive_lookbehind:fixed-regexp). Some examples are
okay so here's what those lookarounds actually look like when you let them cook 💅
$x = "I catch the housecat 'Tom-cat' with catnip";
$x =~ /cat(*pla:\s)/; # matches 'cat' in 'housecat'
@catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
# $catwords[0] = 'catch'
# $catwords[1] = 'catnip'
$x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
$x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
# middle of $xso notice bestie — the parentheses in all of these are non-capturing, because these are zero-width assertions. they don't eat any characters, they just peek 👀. so in that second regexp, the substrings that get captured are the ones from the whole regexp itself, not from the lookaround.
lookahead can match arbitrary regexps, but lowkey there's a catch: lookbehind before 5.30 — like (?<=fixed-regexp) — only works for regexps of fixed width, meaning a fixed number of characters long. so (?<=(ab|bc))? totally fine ✨. but (?<=(ab)*) before 5.30? nope, not happening 💀.
now for the negated versions of lookahead and lookbehind — those are (?!regexp) and (?<!fixed-regexp). or, starting in 5.32 (experimental back in 5.28), you can also write (*nla:regexp), (*negative_lookahead:regexp), (*nlb:regexp), or (*negative_lookbehind:regexp). these evaluate true if the regexps do not match:
$x = "foobar";
$x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
$x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
$x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'and here's an example where a string full of blank-separated words, numbers and single dashes needs to get split into its components. using /\s+/ alone won't work, because spaces are not required between dashes, or between a word and a dash. so we establish extra places to split by looking ahead and behind at the same time 🫶:
$str = "one two - --6-8";
@toks = split / \s+ # a run of spaces
| (?<=\S) (?=-) # any non-space followed by '-'
| (?<=-) (?=\S) # a '-' followed by any non-space
/x, $str; # @toks = qw(one two - - - 6 - 8)✨ Using independent subexpressions to prevent backtracking ✨
independent subexpressions (also called atomic subexpressions) are regexps that, when sitting inside a bigger regexp, just… do their own thing. they function independently of the larger regexp. meaning: they consume as much or as little of the string as they want, and they genuinely do not care whether the bigger regexp manages to match or not 😤. main character energy fr fr.
they're written as (?>regexp) or — starting in 5.32, experimental in 5.28 — (*atomic:regexp).
let's illustrate by comparing to an ordinary regexp first:
$x = "ab";
$x =~ /a*ab/; # matchesobviously this matches, but check what happened on the way there: the subexpression a* first grabbed the 'a'. doing that, though, would've stopped the whole regexp from matching, so after backtracking, a* eventually gave the 'a' back and matched the empty string instead. so here, what a* matched was dependent on what the rest of the regexp matched. it was the group project member who actually adjusts their part 🙈.
now contrast that with an independent subexpression:
$x =~ /(?>a*)ab/; # doesn't match!the independent subexpression (?>a*) does not care about the rest of the regexp, so it sees an 'a' and just takes it 💅. then the rest of the regexp, ab, cannot match. and because (?>a*) is independent, there's no backtracking — it does not give up its 'a'. so the match of the regexp as a whole fails. no notes, that's just how she is.
a similar behavior happens with completely independent regexps:
$x = "ab";
$x =~ /a*/g; # matches, eats an 'a'
$x =~ /\Gab/g; # doesn't match, no 'a' availablehere /g and \G create a "tag team" handoff of the string from one regexp to the other. regexps with an independent subexpression work much like this: handoff of the string to the independent subexpression, then handoff of the string back to the enclosing regexp. iconic teamwork honestly 🤝.
the ability of an independent subexpression to block backtracking can be seriously useful. say we want to match a non-empty string enclosed in parentheses, up to two levels deep. then this regexp matches:
$x = "abc(de(fg)h"; # unbalanced parentheses
$x =~ /\( ( [ ^ () ]+ | \( [ ^ () ]* \) )+ \)/xx;this matches an open parenthesis, one or more copies of an alternation, and a close parenthesis. the alternation is two-way: the first alternative [^()]+ matches a substring with no parentheses, and the second alternative \([^()]*\) matches a substring delimited by parentheses.
the problem 👑 is that this regexp is pathological — it has nested indeterminate quantifiers of the form (a+|b)+. we talked about this back in Part 1: nested quantifiers like this can take an exponentially long time to execute if there's no match possible. to stop that exponential blowup, we need to prevent useless backtracking somewhere. and we do that by wrapping the inner quantifier as an independent subexpression:
$x =~ /\( ( (?> [ ^ () ]+ ) | \([ ^ () ]* \) )+ \)/xx;here, (?>[^()]+) breaks the degeneracy of string partitioning by gobbling up as much of the string as possible and keeping it. then match failures fail much more quickly. speed, she ate 🔥.
🌸 Conditional expressions 🌸
a conditional expression is basically an if-then-else statement, but inside regexp land — it lets you choose which patterns get matched, based on some condition. there are two types:
(?(condition)yes-regexp)(?(condition)yes-regexp|no-regexp)
(?(condition)yes-regexp) is like an if () {} statement in Perl. condition true → the yes-regexp gets matched. condition false → the yes-regexp gets skipped and Perl moves onto the next regexp element. the second form is like an if () {} else {} in Perl: condition true → yes-regexp gets matched, otherwise → no-regexp gets matched.
now, the condition can take several forms:
- an integer in parentheses —
(integer). it's true if the corresponding backreference\integermatched earlier in the regexp. same thing works with a name attached to a capture group, written as(<name>)or('name'). - a bare zero-width assertion —
(?...), so that's a lookahead, a lookbehind, or a code assertion (coming up in the next section 👀). - recursion tests — these return true if the expression is being executed within a recursion
(R), or if it's being called from some capturing group, referenced either by number ((R1),(R2), …) or by name ((R&name)).
the integer or name form of the condition lets us pick, super flexibly, what to match based on what matched earlier in the regexp. this one here hunts for words of the form $x$x or $x$y$y$x:
% simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
beriberi
coco
couscous
deed
...
toot
toto
tututhe lookbehind condition lets an earlier part of the match influence a later part of the match — combined with backreferences, obviously. for instance:
/[ATGC]+(?(?<=AA)G|C)$/;matches a DNA sequence such that it either ends in AAG, or in some other base pair combination and 'C'. and bestie, tiny detail that matters: the form is (?(?<=AA)G|C), not (?((?<=AA))G|C). for the lookahead, lookbehind or code assertions, the parentheses around the conditional are not needed 🎀.
💜 Defining named patterns 💜
some regexps repeat the exact same subpattern in several places. starting with Perl 5.10, you can define named subpatterns in a section of the pattern itself, then call them up by name anywhere in the pattern. the definition group looks like this: (?(DEFINE)(?<name>pattern)...). and inserting a named pattern is written as (?&name).
the example below shows this off using the floating point number pattern from earlier. the three subpatterns used more than once are the optional sign, the digit sequence for an integer, and the decimal fraction. the DEFINE group at the end of the pattern holds their definitions. notice that the decimal fraction pattern is the first place where we get to reuse the integer pattern ♻️✨:
/^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
(?: [eE](?&osg)(?&int) )?
$
(?(DEFINE)
(?<osg>[-+]?) # optional sign
(?<int>\d++) # integer
(?<dec>\.(?&int)) # decimal fraction
)/x🦋 Recursive patterns 🦋
this feature (introduced in Perl 5.10) significantly extends the power of Perl's pattern matching, and it's genuinely a big deal. by referring to some other capture group anywhere in the pattern with the construct (?group-ref), the pattern inside the referenced group gets used as an independent subpattern in place of the group reference itself. and because the group reference may be contained within the group it refers to, you can now apply pattern matching to tasks that used to require a whole recursive parser. glow up of the century 💅.
to show it off, let's design a pattern that matches if a string contains a palindrome. (a palindrome is a word or sentence that — ignoring spaces, interpunctuation and case — reads the same backwards as forwards.) we start by observing that the empty string, or a string with just one word character, is a palindrome. otherwise it has to have a word character up front and the same one at its end, with another palindrome in between:
/(?: (\w) (?...Here be a palindrome...) \g{ -1 } | \w? )/xadding \W* at either end to get rid of the stuff we're ignoring, and we already have the full pattern:
my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
print "'$s' is a palindrome\n" if $s =~ /$pp/;
}in (?...) you can use both absolute and relative backreferences. the entire pattern can be reinserted with (?R) or (?0). and if you prefer naming your groups, you can use (?&name) to recurse into that group. choose your fighter, they all slay 🫶.
⭐ A bit of magic: executing Perl code in a regular expression ⭐
normally, regexps are a part of Perl expressions. code evaluation expressions flip that whole thing around by letting arbitrary Perl code be part of a regexp. a code evaluation expression is denoted (?{code}), where code is a string of Perl statements.
okay so a code expression is literally a zero-width assertion — it doesn't gobble any characters — and what it hands back totally depends on the environment it's living in. 💖 There are exactly two possibilities: either the code expression is being used as the conditional inside a conditional expression (?(condition)...), or it is not. 🫶
Case one: it is a conditional → the code gets evaluated, and the result (i.e., the result of the last statement) decides truth or falsehood. Case two: it is not used as a conditional → the assertion always evaluates true, and the result gets parked in the special variable $^R. 🌸 Then $^R can be used in code expressions later on in the regexp. main character energy fr fr.
Here are some silly examples:
$x = "abcdef";
$x =~ /abc(?{print "Hi Mom!";})def/; # matches,
# prints 'Hi Mom!'
$x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
# no 'Hi Mom!'Pay careful attention to the next example, bestie, I'm not playing:
$x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
# no 'Hi Mom!'
# but why not?At first glance you'd think it shouldn't print, because obviously the ddd isn't going to match the target string. But look at this one:
$x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
# but _does_ printHmm. What happened here? If you've been following along, you know that the above pattern should be effectively (almost) the same as the last one; enclosing the d in a character class isn't going to change what it matches. So why does the first not print while the second one does? 😭
The answer lies in the optimizations the regexp engine makes. In the first case, all the engine sees are plain old characters (aside from the ?{} construct). It's smart enough to realize that the string ddd doesn't occur in our target string before actually running the pattern through. But in the second case, we've tricked it into thinking that our pattern is more complicated. It takes a look, sees our character class, and decides that it will have to actually run the pattern to determine whether or not it matches, and in the process of running it hits the print statement before it discovers that we don't have a match. sneaky little engine 💅
To take a closer look at how the engine does optimizations, see the section "Pragmas and debugging" below.
More fun with ?{} 🎀:
$x =~ /(?{print "Hi Mom!";})/; # matches,
# prints 'Hi Mom!'
$x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
# prints '1'
$x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
# prints '1'The bit of magic mentioned in the section title pops off when the regexp backtracks in the process of searching for a match. 🔥 If the regexp backtracks over a code expression and if the variables used within are localized using local, the changes in the variables produced by the code expression are undone! So if we wanted to count how many times a character got matched inside a group, we could use, e.g.
$x = "aaaa";
$count = 0; # initialize 'a' count
$c = "bob"; # test if $c gets clobbered
$x =~ /(?{local $c = 0;}) # initialize count
( a # match 'a'
(?{local $c = $c + 1;}) # increment count
)* # do this any number of times,
aa # but match 'aa' at the end
(?{$count = $c;}) # copy local $c var into $count
/x;
print "'a' count is $count, \$c variable is '$c'\n";This prints
'a' count is 2, $c variable is 'bob'If we replace the (?{local $c = $c + 1;}) with (?{$c = $c + 1;}), the variable changes are not undone during backtracking, and we get
'a' count is 4, $c variable is 'bob'Note that only localized variable changes are undone. 💀 Other side effects of code expression execution are permanent. Thus
$x = "aaaa";
$x =~ /(a(?{print "Yow\n";}))*aa/;produces
Yow
Yow
Yow
YowThe result $^R is automatically localized, so that it will behave properly in the presence of backtracking. 🦋
This example uses a code expression in a conditional to match a definite article, either the in English or der|die|das in German:
$lang = 'DE'; # use German
...
$text = "das";
print "matched\n"
if $text =~ /(?(?{
$lang eq 'EN'; # is the language English?
})
the | # if so, then match 'the'
(der|die|das) # else, match 'der|die|das'
)
/xi;Note that the syntax here is (?(?{...})yes-regexp|no-regexp), not (?((?{...}))yes-regexp|no-regexp). In other words, in the case of a code expression, we don't need the extra parentheses around the conditional. ⭐
If you try to use code expressions where the code text is contained within an interpolated variable, rather than appearing literally in the pattern, Perl may surprise you:
$bar = 5;
$pat = '(?{ 1 })';
/foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
/foo(?{ 1 })$bar/; # compiles ok, $bar interpolated
/foo${pat}bar/; # compile error!
$pat = qr/(?{ $foo = 1 })/; # precompile code regexp
/foo${pat}bar/; # compiles okIf a regexp has a variable that interpolates a code expression, Perl treats the regexp as an error. If the code expression is precompiled into a variable, however, interpolating is ok. The question is, why is this an error? 🤔
The reason is that variable interpolation and code expressions together pose a security risk. The combination is dangerous because many programmers who write search engines often take user input and plug it directly into a regexp:
$regexp = <>; # read user-supplied regexp
$chomp $regexp; # get rid of possible newline
$text =~ /$regexp/; # search $text for the $regexpIf the $regexp variable contains a code expression, the user could then execute arbitrary Perl code. For instance, some joker could search for system('rm -rf *'); to erase your files. 😱 In this sense, the combination of interpolation and code expressions taints your regexp. So by default, using both interpolation and code expressions in the same regexp is not allowed. If you're not concerned about malicious users, it is possible to bypass this security check by invoking use re 'eval':
use re 'eval'; # throw caution out the door
$bar = 5;
$pat = '(?{ 1 })';
/foo${pat}bar/; # compiles okbestie that comment says it all — # throw caution out the door. you have been warned. 🙈
Another form of code expression is the pattern code expression. The pattern code expression is like a regular code expression, except that the result of the code evaluation is treated as a regular expression and matched immediately. A simple example is
$length = 5;
$char = 'a';
$x = 'aaaaabb';
$x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'This final example contains both ordinary and pattern code expressions. It detects whether a binary string 1101010010001... has a Fibonacci spacing 0,1,1,2,3,5,... of the '1''s:
$x = "1101010010001000001";
$z0 = ''; $z1 = '0'; # initial conditions
print "It is a Fibonacci sequence\n"
if $x =~ /^1 # match an initial '1'
(?:
((??{ $z0 })) # match some '0'
1 # and then a '1'
(?{ $z0 = $z1; $z1 .= $^N; })
)+ # repeat as needed
$ # that is all there is
/x;
printf "Largest sequence matched was %d\n", length($z1)-length($z0);Remember that $^N is set to whatever was matched by the last completed capture group. This prints
It is a Fibonacci sequence
Largest sequence matched was 5Ha! Try that with your garden variety regexp package... 👑 no cap, that's genuinely iconic.
Note that the variables $z0 and $z1 are not substituted when the regexp is compiled, as happens for ordinary variables outside a code expression. Rather, the whole code block is parsed as perl code at the same time as perl is compiling the code containing the literal regexp pattern. 🌈
This regexp without the /x modifier is
/^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/which shows that spaces are still possible in the code parts. Nevertheless, when working with code and conditional expressions, the extended form of regexps is almost necessary in creating and debugging regexps. 💅
🎀 Backtracking control verbs 🎀
Perl 5.10 introduced a number of control verbs intended to provide detailed control over the backtracking process, by directly influencing the regexp engine and by providing monitoring techniques. See "Special Backtracking Control Verbs" in perlre for a detailed description. ✨
Below is just one example, illustrating the control verb (*FAIL), which may be abbreviated as (*F). If this is inserted in a regexp it will cause it to fail, just as it would at some mismatch between the pattern and the string. Processing of the regexp continues as it would after any "normal" failure, so that, for instance, the next position in the string or another alternative will be tried. As failing to match doesn't preserve capture groups or produce results, it may be necessary to use this in combination with embedded code. 🔥
my %count;
"supercalifragilisticexpialidocious" =~
/([aeiou])(?{ $count{lc($1)}++; })(*FAIL)/i;
printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);The pattern begins with a class matching a subset of letters. Whenever this matches, a statement like $count{'a'}++; is executed, incrementing the letter's counter. Then (*FAIL) does what it says, and the regexp engine proceeds according to the book: as long as the end of the string hasn't been reached, the position is advanced before looking for another vowel. Thus, match or no match makes no difference, and the regexp engine proceeds until the entire string has been inspected. 🦋
(In a real program, you might instead solve this problem using
my $string = "supercalifragilisticexpialidocious";
my %count;
$count{lc($1)}++ while $string =~ /([aeiou])/ig;
printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);This is faster than embedded code blocks in the regex.)
🐞 Pragmas and debugging 🐞
Okay so, speaking of debugging (and bestie, we were speaking of debugging) — Perl has a whole lil squad of pragmas for controlling and debugging regexps. We already met one of them back in the previous section: use re 'eval';, which is the one that lets variable interpolation and code expressions coexist inside the same regexp. The rest of the squad is:
use re 'taint';
$tainted = <>;
@parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now taintedThe taint pragma makes it so any substrings that come out of a match against a tainted variable are tainted too, assuming your perl supports tainting at all (peep perlsec). And honestly that's not the normal vibe, because regexps get used all the time to pull the safe little bits out of a tainted variable. So reach for taint when you're not extracting safe bits, and you're doing some other kind of processing instead. Also: both taint and eval pragmas are lexically scoped, which means they're only in effect until the end of the block that encloses them. No lingering, no leftovers 💅
use re '/m'; # or any other flags
$multiline_string =~ /^foo/; # /m is impliedThe re '/flags' pragma (this one showed up in Perl 5.14) turns on whatever regex flags you name, all the way until the end of the lexical scope. More deets live in "'/flags' mode" in re ✨
use re 'debug';
/^(.*)$/s; # output debugging info
use re 'debugcolor';
/^(.*)$/s; # output debugging info in living colorThe global debug and debugcolor pragmas let you get detailed debugging info about regexp compilation and execution. debugcolor is the same as debug, except the debugging info gets shown in color on terminals that can display termcap color sequences. Beautiful. Iconic. Here's some example output:
% perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
Compiling REx 'a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
4: PLUS(7)
5: EXACT <b>(0)
7: EXACT <c>(9)
9: END(0)
floating 'bc' at 0..2147483647 (checking floating) minlen 2
Guessing start of match, REx 'a*b+c' against 'abc'...
Found floating substr 'bc' at offset 1...
Guessed: match at offset 0
Matching REx 'a*b+c' against 'abc'
Setting an EVAL scope, savestack=3
0 <> <abc> | 1: STAR
EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
1 <a> <bc> | 4: PLUS
EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
2 <ab> <c> | 7: EXACT <c>
3 <abc> <> | 9: END
Match successful!
Freeing REx: 'a*b+c'If you've made it this far into the tutorial, you can probably already guess what all the different parts of that debugging output are telling you, but let's go anyway 🫶 The first part:
Compiling REx 'a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
4: PLUS(7)
5: EXACT <b>(0)
7: EXACT <c>(9)
9: END(0)describes the compilation stage. STAR(4) means there's a starred object — in this case 'a' — and if it matches, goto line 4, i.e. PLUS(7). The middle lines describe some heuristics and optimizations that get performed before a match happens:
floating 'bc' at 0..2147483647 (checking floating) minlen 2
Guessing start of match, REx 'a*b+c' against 'abc'...
Found floating substr 'bc' at offset 1...
Guessed: match at offset 0Then the match actually runs and the remaining lines describe the whole process:
Matching REx 'a*b+c' against 'abc'
Setting an EVAL scope, savestack=3
0 <> <abc> | 1: STAR
EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
1 <a> <bc> | 4: PLUS
EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
2 <ab> <c> | 7: EXACT <c>
3 <abc> <> | 9: END
Match successful!
Freeing REx: 'a*b+c'Every step is in the form n <x> <y>, where <x> is the part of the string that got matched and <y> is the part that hasn't been matched yet. The | 1: STAR is saying Perl is at line number 1 in the compilation list up above. For much more detail, check "Debugging Regular Expressions" in perldebguts ✨
Another way to debug regexps is to just embed print statements right inside the regexp. That hands you a full blow-by-blow account of the backtracking happening in an alternation:
"that this" =~ m@(?{print "Start at position ", pos, "\n";})
t(?{print "t1\n";})
h(?{print "h1\n";})
i(?{print "i1\n";})
s(?{print "s1\n";})
|
t(?{print "t2\n";})
h(?{print "h2\n";})
a(?{print "a2\n";})
t(?{print "t2\n";})
(?{print "Done at position ", pos, "\n";})
@x;which prints:
Start at position 0
t1
h1
t2
h2
a2
t2
Done at position 4ate. no crumbs. 🎀
🌈 SEE ALSO 🌈
So this whole thing is just a tutorial, bestie. For the full story on Perl regular expressions, go read the perlre regular expressions reference page 👑
For more info on the matching m// and substitution s/// operators, peek at "Regexp Quote-Like Operators" in perlop. For info on the split operation, it's "split" in perlfunc.
And for an excellent all-around resource on the care and feeding of regular expressions, there's the book Mastering Regular Expressions by Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3) 📚
💖 AUTHOR AND COPYRIGHT 💖
Copyright (c) 2000 Mark Kvale. All rights reserved. Now maintained by Perl porters.
This document may be distributed under the same terms as Perl itself.
🫶 Acknowledgments 🫶
The inspiration for the stop codon DNA example came from the ZIP code example in chapter 7 of Mastering Regular Expressions.
The author would like to thank Jeff Pinyan, Andrew Johnson, Peter Haworth, Ronald J Kimball, and Joe Smith for all their helpful comments 🥹
aaaand that's the whole page, bestie!! perl v5.44.0, dated 2026-10-17, filed under PERLRETUT(1perl) 🦋 go forth and regex responsibly, you absolute legend 💅✨💜
📦 where this page comes from
- arch rolling: perl 5.44.0-1 · Artistic-1.0-Perl AND GPL-1.0-or-later
- 💖 girlified by deepseek-ai/DeepSeek-V4.1-Flash on : a language model's rewrite of the original, under its terms