VCFPRIMERS(1)

✨ vcfprimers ✨

okay bestie, welcome to vcfprimers 💖 — it's a page in section 1 of the manual, and it lives in the vcfprimers family, aka VCF transformation land. buckle up, it's a short one but it's lowkey iconic.

---

🌸 NAME 🌸

vcfprimers — that's the whole name, that's the whole vibe 🫶

---

🎀 SYNOPSIS 🎀

vcfprimers options

yes, she's minimal. just vcfprimers plus your options, periodt. 💅

---

🦋 DESCRIPTION 🦋

so here's the tea ☕ — for each and every VCF record, this tool pulls out the flanking sequences and writes them to stdout as FASTA records, formatted so you can align them. that's it, that's the job. no cap. ✨

---

💖 OPTIONS 💖

• -f, --fasta-reference — the FASTA reference file you hand over so the tool can go grab the primer sequences from it 🧬
• -l, --primer-length — how long you want the primer sequences to be on each side of the variant 📏

---

the part where we explain the actual point 🧚

this tool is made for designing validation experiments, fr fr. 🔬 the primers that get extracted will flank all of the alleles at multi-allelic sites — yes, all of them, she does not pick favorites.

the name of each FASTA "read" tells you which VCF record it belongs to 👑. the form is:

• >CHROM_POS_LEFT for the 3' primer
• >CHROM_POS_RIGHT for the 5' primer

like, for example:

>20_233255_LEFT
CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA
>20_233255_RIGHT
ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA

see how cute that is? 🎀 the chrom, the pos, the side. iykyk.

Type: transformation ⭐

---

🌈 EXIT VALUES 🌈

• 0 — Success 🥳 slay, everything worked
• not 0 — Failure 💀 something went sideways, check yourself

---

🔥 SEE ALSO 🔥

• vcflib(1) — go read the family lore, bestie

---

💜 OTHER 💜

LICENSE

Copyright 2011-2024 (C) Erik Garrison and vcflib contributors. MIT licensed. Copyright 2020-2024 (C) Pjotr Prins. 📜

AUTHORS

Erik Garrison and vcflib contributors. 👑

---

just a lil reminder: this tool is for designing validation experiments, so don't come for it expecting something else. she does flanking sequences, and she does them beautifully. ✨

---

and that's the whole page, bestie!! this was vcfprimers, part of the vcfprimers (vcflib) family — mwah, go forth and design those validation experiments 🫶💅🌸