TRF(1)

💖 TRF — like, the tandem repeat finder?? yeah bestie, it's a User Command 💖

okay so. hi. you're looking at the trf(1) page, and honestly? iconic of you. trf is a little program that goes snooping through DNA and finds tandem repeats, then shows them to you. that's the whole vibe. it's giving "bioinformatics but make it ✨detective✨". let's get into it 🧬🦋

---

✨ NAME ✨

trf — locate and display tandem repeats in DNA sequences 💅

---

🌸 SYNOPSIS 🌸

trf (File|Match|Mismatch|Delta|PM|PI|Minscore|MaxPeriod) [options]

like, that's the shape of it. one file, a bunch of numbers, and then whatever options you're feeling 💖

---

👑 OPTIONS 👑

okay bestie, listen up, because this part is long and you're gonna want to actually read it. here's the where-the-arguments-go situation:

heads up: all weights, penalties, and scores are positive. no negatives, we don't do that here 🙈

• File — the sequences input file. this is your data, your baby, your whole reason for being here 🥺
• Match — the matching weight
• Mismatch — the mismatching penalty
• Delta — the indel penalty
• PM — match probability (whole number, pls, no decimals)
• PI — indel probability (whole number, same deal)
• Minscore — the minimum alignment score it needs to actually bother reporting to you
• MaxPeriod — the maximum period size it's willing to report

---

🎀 [options] = one or more of the following: 🎀

• -m — masked sequence file
• -f — flanking sequence
• -d — data file
• -h — suppress html output. no html for you bestie, keeping it plain 💀
• -r — no redundancy elimination
• -l <n> — maximum TR length expected (in millions) — like, -l 3 or -l=3 both mean 3 million. the human genome HG38 would need -l 6. yes, six million. it's a big girl genome, she contains multitudes 🌈
• -ngs — more compact .dat output on multisequence files, and it returns 0 on success 🫶. the output goes to the screen, not a file — so don't go looking for a file, it's not there. you may pipe input in with this option by using - as the file name. also, short 50 flanks get appended to the .dat output. tiny flanks. little guys. 💖

---

🔥 SEE ALSO 🔥

more info lives on the TRF Unix Help web page, go read it when you're done here:

https://tandem.bu.edu/trf/trf.unix.help.html

---

⭐ NOTE ⭐

ok this one actually matters: the sequence file should be in FASTA format. no cap. if it's not FASTA, it's not gonna go well 😭

and FASTA looks like this, exactly like this, don't improvise:

>Name of sequence
aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag
atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt
actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg

see that > up top? that's the name of the sequence. the rest is the sequence. chef's kiss 🤌

---

💜 AUTHOR 💜

Copyright © 1999-2020 Gary Benson — absolute legend, honestly 👑

this manpage was written by Andreas Tille for the Debian distribution and can be used for any other usage of the program. so generous. so kind. we love that for us 💖

---

okay that's the whole thing!! you're basically a tandem repeat expert now, no big deal 💅✨

trf 4.09.1 · June 2020 · TRF(1) — that's the version, that's the date, that's the manual section, mwah 🎀 bye bestie, go find some repeats 🦋🌸