TQS(1)

📦 version 4.0.1, in debian bookworm, debian trixie, ubuntu jammy, ubuntu noble, ubuntu questing, ubuntu resolute, ubuntu stonking

💖 TQS(1) — the trim quality solexa-illumina sequences era 💖

okay bestie, so this is a page from the General Commands Manual, and it's literally all about tqs and honestly? it's giving "I trim your sequences and I do it flawlessly." 💅 let's get into it.

✨ NAME ✨

tqs — Trim Quality Solexa-Illumina Sequences 🧬🌸

✨ SYNOPSIS ✨

Quality trim solexa-Illumina sequence reads using user-defined thresholds.

no cap, that's the whole vibe. you bring the thresholds, it brings the trimming. 🫶

✨ OPTIONS ✨

  • -h, --help — shows this help message and then dips. classic. 👑
  • -f SEQFILE, --sequence file=SEQFILE — your Illumina sequence file, aka the output format from the 1G Genome Analyzer (_seq.txt). it looks like this, fr fr:
7       1       255     669
AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC
  • -q QUALFILE, --qual file=QUALFILE — a prb file holding all the Illumina intensities, exactly as outputted by the 1G Genome Analyzer (_prb.txt). ✨
  • -l MER, --length=MER — length of the sequence reads, i.e. the number of sequencing cycles. default is 36. 🎀
  • -t THRESHOLD, --threshold=THRESHOLD — base intensity threshold value. the range is -40 to 40, and the default is 5. 🌸
  • -d DIFF, --difference=DIFF — base intensity difference between the top intensity and the second best. range is 1 to 80, default is 5. 🔥
  • -c CONSEC, --consec=CONSEC — minimum number of consecutive bases that have to pass the threshold values. default is 20. 💜
  • -v, --verbose — runs in Verbose mode. it simply says more. we love a chatty icon. 🗣️✨

✨ SEE ALSO ✨

/usr/share/doc/ssake/TQS.readme

go read it bestie, iykyk 📖💖

✨ AUTHORS ✨

This manual page was written by Andreas Tille <tille@debian.org> for the Debian system (but may be used by others). Permission is granted to copy, distribute and/or modify this document under the terms of the GNU General Public License, Version 2 any later version published by the Free Software Foundation. 📜

On Debian systems, the complete text of the GNU General Public License can be found in /usr/share/common-licenses/GPL.

and that's the whole page, bestie!! it's from January 2008, which lowkey makes it vintage in the most iconic way — TQS(1) really said "I've been slaying since 2008 and I'm not stopping." 🎀🦋

📦 where this page comes from