GT-FINGERPRINT(1)

📦
version 1.6.6 · 5 versions
, in ubuntu resolute, ubuntu stonking

💅 GT-FINGERPRINT(1) — the GenomeTools manual, but make it cute

okay bestie, welcome to gt-fingerprint, living under the gt fingerprint command inside the GenomeTools Manual 🦋✨

🌸 NAME 🌸

gt-fingerprint — bestie, this computes MD5 fingerprints for every single sequence in a set of sequence files. every. single. one. 💖

✨ SYNOPSIS ✨

gt fingerprint [option ...] sequence_file [...]

like, that's the whole vibe. options, then as many sequence files as your heart desires 🫶

🎀 DESCRIPTION 🎀

okay so here's the whole menu, no skips, no skimming, we're doing this properly 💅

  • -check [filename] — compares all the fingerprints sitting in the given checklist file against the checksums in the given sequence_file(s). the comparison slays (i.e. succeeds) if every fingerprint in the checkfile can be found in the sequence_file(s) in the exact same quantity, and vice versa. (default: undefined)
  • -duplicates [yes|no] — shows duplicate fingerprints from the given sequence_file(s). (default: no)
  • -extract [string] — extracts the sequence(s) with the given fingerprint from the sequence file(s) and shows them on stdout. (default: undefined)
  • -width [value] — sets the output width for FASTA sequence printing (0 disables formatting). (default: 0)
  • -o [filename] — redirects output to the specified file. (default: undefined)
  • -gzip [yes|no] — writes a gzip compressed output file. (default: no)
  • -bzip2 [yes|no] — writes a bzip2 compressed output file. (default: no)
  • -force [yes|no] — forces writing to the output file. (default: no)
  • -help — displays help and exits. bye bestie 👋
  • -version — displays version information and exits.

so like, if you use neither the -check option nor the -duplicates option, the fingerprints for all sequences get shown on stdout. that's the default main character behaviour 💅

and okay this part matters: a fingerprint of a sequence is case insensitive. so the MD5 fingerprint of two identical sequences will be the same even if one of them is soft-masked. not me being obsessed with case-insensitive equality 😭 iconic.

🌈 EXAMPLES 🌈

compute a (unified) list of fingerprints, periodt:

$ gt fingerprint U89959_ests.fas | sort | uniq > U89959_ests.checklist_uniq

compare fingerprints:

$ gt fingerprint -check U89959_ests.checklist_uniq U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33 only in sequence_file(s)

make sure a sequence file contains no duplicates (not the case here, sadly 💀):

$ gt fingerprint -duplicates U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33        2
gt fingerprint: error: duplicates found: 1 out of 200 (0.500%)

extract the sequence with a given fingerprint, so satisfying 🧚:

$ gt fingerprint -extract 6d3b4b9db4531cda588528f2c69c0a57 U89959_ests.fas
>SQ;8720010
TTTTTTTTTTTTTTTTCCTGACAAAACCCCAAGACTCAATTTAATCAATCCTCAAATTTACATGATAC
CAACGTAATGGGAGCTTAAAAATA

⭐ RETURN VALUES ⭐

  • 0 — everything went fine 💖 (-check: the comparison was successful; -duplicates: no duplicates found)
  • 1 — an error occurred 😭 (-check: the comparison was not successful; -duplicates: duplicates found)

🙈 REPORTING BUGS 🙈

found a bug? report it to https://github.com/genometools/genometools/issues. do it bestie, they wanna know 🫶

ngl, that's the whole page. go fingerprint something. 💅✨

this was GenomeTools 1.6.6, dated 11/09/2025 — mwah, bye bestie 🎀💜

📦 where this page comes from