RNAUP(1)

📦

version 2.7.0 · 5 versions

2.7.0 · ubuntu resolute, ubuntu stonking (latest)
2.4.17 · ubuntu jammy
2.5.1 · ubuntu noble
2.5.1 · debian bookworm
2.6.4 · debian trixie, ubuntu questing

🦋 RNAUP(1) — the User Commands manual 💖

✨ NAME ✨

bestie, the whole NAME section is just RNAup - manual page for RNAup 2.7.0 💅

💖 SYNOPSIS 💖

RNAup [OPTION]...

so you type RNAup and then toss in whatever OPTIONs you want 🫶

🌸 DESCRIPTION 🌸

RNAup 2.7.0 🌈

Calculate the thermodynamics of RNA-RNA interactions ✨

okay so RNAup calculates the thermodynamics of RNA-RNA interactions by splitting the binding into two stages 🧚 Stage one: it computes the probability that a potential binding site stays unpaired (which is equivalent to the free energy needed to open the site). Stage two: that accessibility gets combined with the interaction energy to give you the total binding energy. All of the calculations are done by computing partition functions over all possible conformations 🧠

RNAup has two different modes 👑 By default, RNAup computes accessibilities, in terms of the free energies needed to open a region (default length 4). It prints the region of highest accessibility and its opening energy to stdout, and the opening energies for all the other regions get written to a file.

In interaction mode, the interaction between two RNAs gets calculated. It kicks in if the input is two sequences concatenated with an &, or if you give the -X[pf] or -b options. Unless you use -b, RNAup assumes the longer RNA is the structured target sequence while the shorter one is an unstructured small RNA. Also, for every position along the target sequence, it writes the best free energy of binding for an interaction that includes that position to the output file. Stdout gets the location and the free energy, dG, for the optimal region of interaction. The binding energy dG is also split into its components: the interaction energy dGint and the opening energy dGu_l (and possibly dGu_s for the shorter sequence) 💅

It also prints the optimal interaction structure as computed by RNAduplex for this region. Heads up though: the RNAduplex optimal interaction doesn't always match the optimal RNAup region 👀 If the two predictions don't match, the structure string gets replaced by a run of "." and a message is written to stderr.

Each sequence should be in 5' to 3' direction 🍓 If a sequence is preceded by a line of the form:

> name

then the output file name_ux_up.out is produced, where the x in ux is the value you set with the -u option. Otherwise the file name defaults to RNA_ux_up.out. If a file with the same name already exists, the output gets concatenated onto it.

RNA sequences are read from stdin as strings of characters. White space and newline within a sequence cause an error! Newline is used to separate sequences. The program keeps reading new sequences until it hits a line consisting of the single character @, or an end of file condition.

🎀 General Options

-h, --help — Print help and exit 🙋
--detailed-help — Print help, including all details and hidden options, and exit 🧾
--full-help — Print help, including hidden options, and exit
-V, --version — Print version and exit 🔖
-v, --verbose — Be verbose. (default=off) Basically, it lowers the log level setting so even INFO messages get passed through 📣

📮 I/O Options

Command line options for input and output (pre-)processing. 🫧

-o, --no_output_file — Do not produce an output file. (default=off)
--no_header — Do not produce a header with the command line parameters used in the outputfile. (default=off)
--noconv — Do not automatically substitute nucleotide "T" with "U". (default=off)
--log-level=level — Set log level threshold. (default=`2') By default, log messages get filtered so only warnings (level 2) or errors (level 3) get printed. This setting lets you pick the threshold, and higher values mean fewer informational messages. Log-level 5 turns off all messages, even errors and other critical info 🙈
--log-file[=filename] — Print log messages to a file instead of stderr. (default=`RNAup.log')
--log-time — Include a time stamp in log messages. (default=off) ⏰
--log-call — Include the file and line of the log calling function. (default=off)

🧮 Algorithms

Select additional algorithms which should be included in the calculations. 🧠

-u, --ulength=length — Specify the length of the unstructured region in the output. (default=4') The probability of being unpaired gets plotted on the right border of the unpaired region. You can specify up to 20 different length values: use "-" for a range of continuous values (e.g. -u 4-8), or give a list of comma separated values (e.g. -u 4,8,15`). ✨
-c, --contributions=SHIME — Specify the contributions listed in the output. (default=S') By default, only the full probability of being unpaired is plotted. The -c` option lets you see the different contributions (c) to the probability of being unpaired. The full probability of being unpaired ("S") is the sum of the probability of being unpaired in the exterior loop ("E"), within a hairpin loop ("H"), within an internal loop ("I") and within a multiloop ("M"). Any combination of these letters may be given 💜

⚠️ Use with caution, bestie! This value gets quietly reset to 3.4 if you load DNA parameters with -P DNA and don't give it a value of your own. 💀

--backbone-length=FLOAT — Sets the average backbone length for looped regions, in Angstrom units. 📏✨
- default: 6.0

⚠️ Use with caution, bestie! This value gets re-set automatically to 6.76 if you load DNA parameters with -P DNA and don't provide a value. 🫣

📚 REFERENCES 📚

If you use this program in your work, you might wanna cite:

R. Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F. Stadler and I.L. Hofacker (2011), "ViennaRNA Package 2.0", Algorithms for Molecular Biology: 6:26 🧬
I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994), "Fast Folding and Comparison of RNA Secondary Structures", Monatshefte f. Chemie: 125, pp 167-188 🌸
R. Lorenz, I.L. Hofacker, P.F. Stadler (2016), "RNA folding with hard and soft constraints", Algorithms for Molecular Biology 11:1 pp 1-13 💜
U. Mueckstein, H. Tafer, J. Hackermueller, S.H. Bernhart, P.F. Stadler, and I.L. Hofacker (2006), "Thermodynamics of RNA-RNA Binding", Bioinformatics: 22(10), pp 1177-1182 🦋

The energy parameters are taken from:

D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J. Susan, M. Zuker, D.H. Turner (2004), "Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure", Proc. Natl. Acad. Sci. USA: 101, pp 7287-7292 🔥
D.H Turner, D.H. Mathews (2009), "NNDB: The nearest neighbor parameter database for predicting stability of nucleic acid secondary structure", Nucleic Acids Research: 38, pp 280-282 📖

🧪 EXAMPLES 🧪

Output to stdout

Okay so in Interaction mode, RNAup prints the most favorable interaction energy between the two sequences straight to stdout. 👀 That energy (dG) depends on where you are in the longer sequence (region [i,j]) and where you are in the shorter one (region [k,l]): dG[i,j;k,l]. The dG[i,j;k,l] value is the biggest contribution to dG[i,j] = sum_kl dG[i,j;k,l], which lands in the output file, so dG[i,j;k,l] <= dG[i,j] always. It's giving math-girl energy 🧮💅

'....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8'
> franz
GGAGUAGGUUAUCCUCUGUU
> sissi
AGGACAACCU
dG = dGint + dGu_l
(((((.((((&)))).)))))   6,15  :   1,10  (-6.66 = -9.89 + 3.23)
AGGUUAUCCU&AGGACAACCU
RNAup output in file: franz_sissi_w25_u3_4_up.out

The result line holds this info, bestie:

RNAduplex results       [i,j]     [k,l]    dG = dGint + dGu_l
(((((.((((&)))).)))))   6,15   :  1,10     (-6.66=-9.89+3.23)

Output to file

The output file has a header with the date, the exact command line you ran RNAup with, and the length and names of the input sequence(s), followed by the sequence(s) themselves. The first sequence is always the target sequence. 📝 If you don't want the header, just use the -nh option. 🙅‍♀️

Right after the header comes the line with the column names:

  position     dGu_l for -u 3      dGu_l for -u 4       dG
#     pos      u3S       u3H       u4S       u4H        dG

Everything here refers to the target sequence. ✨ The dGu_l column tells you the -u value (u=3 or u=4) and how much it costs in free energy to open all structures "S" or only hairpin loops "H" (see option -c). If you see NA, it means no result is possible, like column u3S row 2, where there's no region of length 3 ending at position 2. That's just how it goes sometimes 🥺

#  Thu Apr 10 09:15:11 2008
#  RNAup -u 3,4 -c SH -b
#  20 franz
#  GGAGUAGGUUAUCCUCUGUU
#  10 sissi
#  AGGACAACCU
#     pos      u3S       u3H       u4S       u4H        dG
       1        NA        NA        NA        NA    -1.540
       2        NA        NA        NA        NA    -1.540
       3     1.371        NA        NA        NA    -1.217
       4     1.754     5.777     1.761        NA    -1.393
       5     1.664     3.140     1.811     5.800    -1.393

If you select the -b option, the position and dGu_s values for the shorter sequence get written right after the info for the target sequence. 🎀

👑 AUTHOR 👑

Ivo L Hofacker, Peter F Stadler, Ulrike Mueckstein, Ronny Lorenz 🌈

🐛 REPORTING BUGS 🐛

If in doubt, our program is right and nature is at fault. 🙃 Comments should be sent to rna@tbi.univie.ac.at 💌

That's the whole tea, bestie! 🫶 You're now officially an RNAup girlie 💖 Sealed with love from RNAup 2.7.0, February 2026 🦋✨

📦 where this page comes from

ubuntu resolute: vienna-rna 2.7.0+dfsg-2 · non-free
ubuntu stonking: vienna-rna 2.7.0+dfsg-2 · non-free
💖 girlified by claude-haiku-5-5 on 2026-10-12: a language model's rewrite of the original, under its terms