Bio::T...UBlast(3pm)

okay bestie, this is the manual page for Bio::Tools::Run::StandAloneWUBlast from section 3pm of the perl docs 💅 (the header up top is just that name, all squished and truncated: Bio::T...UBlast(3pm) — she's on a budget, we love her anyway 🎀)

---

✨ NAME ✨

Bio::Tools::Run::StandAloneWUBlast — the object that handles local execution of WU-Blast, aka running WU-Blast on your own machine, no remote server energy, just you and your box 🖥️🔥

---

🌸 SYNOPSIS 🌸

# Do not use directly; use Bio::Tools::Run::StandAloneBlast

fr fr, do NOT come for this module directly, go through Bio::Tools::Run::StandAloneBlast like a civilized human 🙈

---

🦋 DESCRIPTION 🦋

See Bio::Tools::Run::StandAloneBlast. that's the whole description bestie, she's mysterious, she's lowkey a private account 🔒✨

---

💌 FEEDBACK 💌

📬 Mailing Lists

User feedback is, like, the entire point of this module and every other Bioperl module evolving and getting better. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is genuinely so appreciated, no cap 🫶

  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

🫶 Support

Please direct usage questions and support issues to the mailing list:

bioperl-l@bioperl.org

...rather than sliding into the module maintainer's DMs directly 💀 there are so many experienced and responsive experts on that list who can look at your problem and address it fast. Please include a thorough description of the problem, plus code and data examples, if at all possible. receipts help everybody 📎✨

🐛 Reporting Bugs

Report bugs to the Bioperl bug tracking system so we can keep track of the bugs and their resolution — main character bug-fixing energy 👑 Bug reports can be submitted via the web:

  https://github.com/bioperl/bioperl-live/issues

---

👑 AUTHOR - Peter Schattner

Email schattner at alum.mit.edu — icon, legend, the originator 💜

🛠️ MAINTAINER - Torsten Seemann

Email torsten at infotech.monash.edu.au — holding it down 🫡

🌈 CONTRIBUTORS

Sendu Bala bix@sendu.me.uk (reimplementation) — the way she reimplemented the whole thing?? ate 💅

---

📖 APPENDIX 📖

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _ (that underscore is the "do not touch, this is backstage" signal, iykyk 🙈).

🆕 new

• Title: new
• Usage: my $obj = Bio::Tools::Run::StandAloneBlast->new();
• Function: Builds a new Bio::Tools::Run::StandAloneBlast object
• Returns: Bio::Tools::Run::StandAloneBlast
• Args:
  • -quiet => boolean — make program execution quiet 🤫
  • -_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull' — the parsing method, case insensitive

Essentially all BLAST parameters can be set via StandAloneBlast.pm. Some of the most commonly used parameters are listed below. All parameters have defaults and are optional except for -p ⚠️

• -p Program Name [String] — Input should be one of "wublastp", "wublastn", "wublastx", "wutblastn", or "wutblastx".
• -d Database [String] default = nr — The database specified must first be formatted with xdformat.
• -E Expectation value (E) [Real] default = 10.0
• -o BLAST report Output File [File Out] Optional, default = ./blastreport.out ; set by StandAloneBlast.pm

🚀 wublast

• Title: wublast
• Usage:

 $blast_report = $factory->wublast('t/testquery.fa');

or

        $input = Bio::Seq->new(-id=>"test query",
                               -seq=>"ACTACCCTTTAAATCAGTGGGGG");
        $blast_report = $factory->wublast($input);

or

       $seq_array_ref = \@seq_array;  # where @seq_array is an array of Bio::Seq objects
       $blast_report = $factory->wublast(\@seq_array);

• Returns: Reference to a Blast object
• Args: Name of a file or Bio::Seq object or an array of Bio::Seq object containing the query sequence(s). Throws an exception if argument is not either a string (eg a filename) or a reference to a Bio::Seq object (or to an array of Seq objects). If argument is string, throws exception if file corresponding to string name can not be found.

🔧 _generic_local_wublast

• Title: _generic_local_wublast
• Usage:

 $blast_report = ...

internal function, not called directly, bestie, hands off 🙅

• Returns: Blast object
• Args: Reference to calling object and name of BLAST executable

⚙️ _runwublast

• Title: _runwublast
• Usage: Internal function, not to be called directly
• Function: makes actual system call to WU-Blast program
• Example:
• Returns: Report Blast object
• Args: Reference to calling object, name of BLAST executable, and parameter string for executable

🎛️ _setparams

• Title: _setparams
• Usage: Internal function, not to be called directly
• Function: Create parameter inputs for Blast program
• Example:
• Returns: parameter string to be passed to Blast
• Args: Reference to calling object and name of BLAST executable

---

okay that's the whole page, you made it to the end, slay 🎉 this little cutie is perl v5.36.0, dated 2023-01-22, and the footer's out here truncating her name to Bio::T...UBlast(3pm) like she's a contact saved in 2011 😭💖 go forth and BLAST locally, bestie 🦋✨