Bio::T...IBlast(3pm)

📦
version 1.7.3 · 3 versions
, in debian bookworm, ubuntu noble

NAME 💖

okay bestie, you've landed on the Bio::T...IBlast(3pm) page, and it's the manual for Bio::Tools::Run::StandAloneNCBIBlast. 💅

So what is it? It's the object that handles running the whole NCBI BLAST program suite — blastall, blastpgp, bl2seq — locally, on your own machine. And there's experimental support for NCBI rpsblast too. Experimental means it's still in its trial era, so be gentle with it. 🦋

SYNOPSIS ✨

# Do not use directly; see Bio::Tools::Run::StandAloneBlast

Literally do not use it directly, bestie. Go through Bio::Tools::Run::StandAloneBlast. 🙈

DESCRIPTION 🌸

See Bio::Tools::Run::StandAloneBlast. That's the whole description. It's giving minimal. 💀

FEEDBACK 🫶

Mailing Lists 🌈

User feedback is an integral part of the evolution of this and every other Bioperl module, no cap. Send your comments and suggestions to one of the Bioperl mailing lists — your participation is so appreciated. 🥹

bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Support 💜

Please direct usage questions and support issues to the mailing list:

bioperl-l@bioperl.org

...rather than going straight to the module maintainer, okay? There are so many experienced and responsive experts on that list who can look at your problem and address it quickly. And please include a thorough description of the problem, with code and data examples, if at all possible. The more detail the better. 💅

Reporting Bugs 🐛

Report bugs to the Bioperl bug tracking system so we can keep track of the bugs and their resolutions. Bug reports can be submitted via the web:

https://github.com/bioperl/bioperl-live/issues

AUTHOR — Peter Schattner 👑

Email schattner at alum.mit.edu

MAINTAINER — Torsten Seemann 💅

Email torsten at infotech.monash.edu.au

CONTRIBUTORS 🎀

Sendu Bala bix@sendu.me.uk (reimplementation)

APPENDIX 📚

The rest of this doc goes deep on each of the object methods. Internal methods usually have a _ in front of them, so if you see an underscore, that's an inside-job method, don't touch it. 🤫

new 🌟

  • Title: new
  • Usage: my $obj = Bio::Tools::Run::StandAloneBlast->new();
  • Function: Builds a newBio::Tools::Run::StandAloneBlast object
  • Returns: Bio::Tools::Run::StandAloneBlast
  • Args:
    • -quiet => boolean — makes program execution quiet 🤫
    • -_READMETHOD => 'BLAST' (the default, and it's a synonym for 'SearchIO') || 'blast_pull' — this is the parsing method, and it's case insensitive.

Essentially all BLAST parameters can be set via StandAloneBlast.pm. Some of the most commonly used parameters are listed below. All parameters have defaults and are optional — except for -p in those programs that have it. For a complete listing of settable parameters, run the relevant executable BLAST program with the option "-", as in blastall. And a heads up, bestie: the input parameters (-i, -j, -input) should not be set directly by you — this module sets them when you call one of the executable methods. ✋

Blastall 💥

  • -p — Program Name [String]. Input should be one of "blastp", "blastn", "blastx", "tblastn", or "tblastx".
  • -d — Database [String], default = nr. The database specified must first be formatted with formatdb. Multiple database names (bracketed by quotations) will be accepted. An example would be -d "nr est".
  • -e — Expectation value (E) [Real], default = 10.0
  • -o — BLAST report Output File [File Out], Optional, default = ./blastreport.out ; set by StandAloneBlast.pm
  • -S — Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer], default = 3

Blastpgp (including Psiblast) 🧬

  • -j — the maximum number of rounds (default 1; i.e., regular BLAST)
  • -h — the e-value threshold for including sequences in the score matrix model (default 0.001)
  • -c — the "constant" used in the pseudocount formula specified in the paper (default 10)
  • -B — Multiple alignment file for PSI-BLAST "jump start mode", Optional
  • -Q — Output File for PSI-BLAST Matrix in ASCII [File Out], Optional

rpsblast 🌟

  • -d — Database [String], default = (none — you must specify a database). The database specified must first be formatted with formatdb. Multiple database names (bracketed by quotations) will be accepted. An example would be -d "Cog Smart".
  • -e — Expectation value (E) [Real], default = 10.0
  • -o — BLAST report Output File [File Out], Optional, default = ./blastreport.out ; set by StandAloneBlast.pm

Bl2seq 🎀

  • -p — Program name: blastp, blastn, blastx. For blastx the 1st argument should be nucleotide [String], default = blastp
  • -o — alignment output file [File Out], default = stdout
  • -e — Expectation value (E) [Real], default = 10.0
  • -S — Query strands to search against database (blastn only). 3 is both, 1 is top, 2 is bottom [Integer], default = 3

blastall 🔥

  • Title: blastall
  • Usage, three whole ways:
$blast_report = $factory->blastall('t/testquery.fa');

or

$input = Bio::Seq->new(-id=>"test query",
                       -seq=>"ACTACCCTTTAAATCAGTGGGGG");
$blast_report = $factory->blastall($input);

or

$seq_array_ref = \@seq_array;
# where @seq_array is an array of Bio::Seq objects
$blast_report = $factory->blastall($seq_array_ref);
  • Returns: a reference to a Blast object containing the blast report.
  • Args: the name of a file, or a Bio::Seq object, or an array of Bio::Seq objects containing the query sequence(s). It throws an exception if the argument isn't a string (like a filename) or a reference to a Bio::Seq object (or to an array of Seq objects). And if the argument is a string, it throws an exception if the file corresponding to that string name can't be found. 😭

blastpgp 🧬

  • Title: blastpgp
  • Usage, again, three ways:
$blast_report = $factory-> blastpgp('t/testquery.fa');

or

$input = Bio::Seq->new(-id=>"test query",
                       -seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
$blast_report = $factory->blastpgp ($input);

or

$seq_array_ref = \@seq_array;
# where @seq_array is an array of Bio::Seq objects
$blast_report = $factory-> blastpgp(\@seq_array);
  • Returns: a reference to a Bio::SearchIO object containing the blast report.
  • Args: the name of a file, or a Bio::Seq object. In psiblast jumpstart mode, two extra arguments are required: a SimpleAlign object one of whose elements is the query, and a "mask" to determine how BLAST should select scoring matrices — see the DESCRIPTION above for more details. 👑

It throws an exception if the argument isn't a string (like a filename) or a reference to a Bio::Seq object (or to an array of Seq objects). If the argument is a string, it throws an exception if the file corresponding to that string name can't be found.

  • Returns: a reference to a Bio::SearchIO object containing the blast report. (Yes bestie, Returns shows up twice in this one. It said it, not me. 💀)

rpsblast 🌟

  • Title: rpsblast
  • Usage:
$blast_report = $factory->rpsblast('t/testquery.fa');

or

$input = Bio::Seq->new(-id=>"test query",
                       -seq=>"MVVLCRADDEEQQPPTCADEEQQQVVGG");
$blast_report = $factory->rpsblast($input);

or

$seq_array_ref = \@seq_array;
# where @seq_array is an array of Bio::Seq objects
$blast_report = $factory->rpsblast(\@seq_array);
  • Args: the name of a file, or a Bio::Seq object, or an array of Bio::Seq objects containing the query sequence(s). It throws an exception if the argument isn't a string (like a filename) or a reference to a Bio::Seq object (or to an array of Seq objects). If the argument is a string, it throws an exception if the file corresponding to that string name can't be found.
  • Returns: a reference to a Bio::SearchIO object containing the blast report

bl2seq 🎀

  • Title: bl2seq
  • Usage:
$factory-> bl2seq('t/seq1.fa', 't/seq2.fa');

or

$input1 = Bio::Seq->new(-id=>"test query1",
                        -seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
$input2 = Bio::Seq->new(-id=>"test query2",
                        -seq=>"ACTADDEMMMMMMMDEEQQQVVGG");
$blast_report = $factory->bl2seq ($input1,  $input2);
  • Returns: a reference to a BPbl2seq object containing the blast report.
  • Args: the names of 2 files, or 2 Bio::Seq objects, containing the sequences to be aligned by bl2seq.

It throws an exception if the argument isn't either a pair of strings (like filenames) or references to Bio::Seq objects. If the arguments are strings, it throws an exception if the files corresponding to those string names can't be found.

_generic_local_blast 🤫

  • Title: _generic_local_blast
  • Usage: internal function, not called directly
  • Returns: Bio::SearchIO
  • Args: reference to the calling object, and the name of the BLAST executable

_runblast ⚙️

  • Title: _runblast
  • Usage: Internal function, not to be called directly
  • Function: makes the actual system call to the Blast program
  • Example: (blank in the original — it's leaving that one to your imagination 🙈)
  • Returns: Report Bio::SearchIO object in the appropriate format
  • Args: reference to the calling object, the name of the BLAST executable, and the parameter string for the executable

_setparams 🛠️

  • Title: _setparams
  • Usage: Internal function, not to be called directly
  • Function: Create parameter inputs for the Blast program
  • Example: (also blank, iconic behaviour honestly ✨)
  • Returns: the parameter string to be passed to Blast
  • Args: reference to the calling object, and the name of the BLAST executable

and that's the whole page, bestie!! 🫶 this was Bio::T...IBlast(3pm) from the User Contributed Perl Documentation, perl v5.36.0, dated 2023-01-22. go run some blasts, you've got this 💖🧬✨

📦 where this page comes from