Bio::S...:SubSeq(3pm)

💖 Bio::SeqFeature::SubSeq 💖

okay bestie, welcome to the Bio::SeqFeature::SubSeq page — that's the 3pm manual, straight outta the User Contributed Perl Documentation, and yes we are gonna read the whole thing together. no skimming. 🫶

---

✨ NAME ✨

Bio::SeqFeature::SubSeq — a Feature that's literally representing a subsequence. it's giving "sequence, but make it a feature." 👑

---

🌸 SYNOPSIS 🌸

  # SubSeq with implicit sequence
  use Bio::Seq;
  my $template = Bio::Seq->new( -seq => 'AAAAACCCCCGGGGGTTTTT' );
  $subseq = Bio::SeqFeature::Amplicon->new(
      -start    => 6,
      -end      => 15,
      -template => $template,
  );
  print "Subsequence is: ".$amplicon->seq->seq."\n"; # Should be 'CCCCCGGGGG'

  # SubSeq with explicit sequence
  use Bio::SeqFeature::Subseq;
  my $subseq = Bio::SeqFeature::Amplicon->new(
      -seq => $seq_object,
  );

periodt. that's the whole vibe right there. 💅

---

🦋 DESCRIPTION 🦋

so Bio::SeqFeature::SubSeq extends Bio::SeqFeature::Generic features to represent a subsequence. when this feature gets attached to a template sequence, the sequence of the feature is the subsequence of that template at this location. the whole point of this class? representing a sequence as a feature without having to explicitly store its sequence string. iconic behavior, no notes. ✨

of course, you might have your own reasons to explicitly set a sequence. and in that case, bestie, heads up: the length of the sequence is allowed to not match the position of the feature. fr fr. like, you can set a sequence of length 10 on a SubSeq feature that spans positions 30 to 50 of the template if you so desire. it's your world, we're just living in it. 🙈

---

💌 FEEDBACK 💌

📬 Mailing Lists

user feedback is an integral part of the evolution of this and other Bioperl modules. send your comments and suggestions preferably to one of the Bioperl mailing lists. your participation is much appreciated. 🥹

  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

🫶 Support

please direct usage questions or support issues to the mailing list:

bioperl-l@bioperl.org

rather than to the module maintainer directly. many experienced and reponsive experts will be able look at the problem and quickly address it. please include a thorough description of the problem with code and data examples if at all possible. the more detail the better, bestie — don't leave them guessing. 🎀

🐛 Reporting Bugs

report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. bug reports can be submitted via the web:

  https://github.com/bioperl/bioperl-live/issues

---

👑 AUTHOR 👑

Florent Angly <florent.angly@gmail.com>

shoutout to the author, absolute legend. 🌟

---

📖 APPENDIX 📖

the rest of the documentation details each of the object methods. internal methods are usually preceded with a _. iykyk. 😌

🔧 new

 Title   : new()
 Usage   : my $subseq = Bio::SeqFeature::SubSeq( -start => 1, -end => 10, -strand => -1);
 Function: Instantiate a new Bio::SeqFeature::SubSeq feature object
 Args    : -seq      , the sequence object or sequence string of the feature (optional)
           -template , attach the feature to the provided parent template sequence or feature (optional).
                       Note that you must specify the feature location to do this.
           -start, -end, -location, -strand and all other L<Bio::SeqFeature::Generic> argument can be used.
 Returns : A Bio::SeqFeature::SubSeq object

instantiate a brand new Bio::SeqFeature::SubSeq feature object and get your life. the args are all listed above — -seq and -template are optional, but note that -template needs you to specify the feature location for it to work. and honestly, -start, -end, -location, -strand and every other Bio::SeqFeature::Generic argument are all fair game. go off. 💅

🧬 seq

 Title   : seq()
 Usage   : my $seq = $subseq->seq();
 Function: Get or set the sequence object of this SubSeq feature. If no sequence
           was provided, but the subseq is attached to a sequence, get the
           corresponding subsequence.
 Returns : A sequence object or undef
 Args    : None.

get or set the sequence object of this SubSeq feature. and if no sequence was provided but the subseq is attached to a sequence? it gets you the corresponding subsequence. main character energy. ✨ returns a sequence object or undef, and it takes no args. simple, clean, obsessed. 🎀

📏 length

 Title   : seq()
 Usage   : my $length = $subseq->seq();
 Function: Get the length of the SubSeq feature. It is similar to the length()
           method of L<Bio::Generic::SeqFeature>, which computes length based
           on the location of the feature. However, if the feature was not
           given a location, return the length of the subsequence if possible.
 Returns : integer or undef
 Args    : None.

gets you the length of the SubSeq feature. it's similar to the length() method of Bio::Generic::SeqFeature, which computes length based on the location of the feature. but — and this is the glow-up — if the feature wasn't given a location, it returns the length of the subsequence if possible. returns an integer or undef, and no args. 💖

---

okay that's the whole page, you made it, so proud of you 🥹💖 now go forth and build your subsequences, bestie.

---

and that's a wrap on this one, written by the good people of Bioperl and shipped with perl v5.32.1, dated 2021-08-15. mwah. 💋