Bio::S...mplicon(3pm)

💖 NAME 💖

Bio::SeqFeature::Amplicon — bestie, it's literally an Amplicon feature 💅

Oh and also, hi, you're reading Bio::S...mplicon(3pm) from the User Contributed Perl Documentation, and it's giving Bioperl module realness ✨

---

✨ SYNOPSIS ✨

Okay so here's the vibe, two whole ways to do it 🦋

# Amplicon with explicit sequence
use Bio::SeqFeature::Amplicon;
my $amplicon = Bio::SeqFeature::Amplicon->new(
    -seq        => $seq_object,
    -fwd_primer => $primer_object_1,
    -rev_primer => $primer_object_2,
);

# Amplicon with implicit sequence
use Bio::Seq;
my $template = Bio::Seq->new( -seq => 'AAAAACCCCCGGGGGTTTTT' );
$amplicon = Bio::SeqFeature::Amplicon->new(
    -start => 6,
    -end   => 15,
);
$template->add_SeqFeature($amplicon);
print "Amplicon start   : ".$amplicon->start."\n";
print "Amplicon end     : ".$amplicon->end."\n";
print "Amplicon sequence: ".$amplicon->seq->seq."\n";
# Amplicon sequence should be 'CCCCCGGGGG'

Like, yes, 'CCCCCGGGGG', no cap 🌸

---

🌈 DESCRIPTION 🌈

So Bio::SeqFeature::Amplicon extends Bio::SeqFeature::Subseq — it's the main character that represents an amplicon sequence, plus the optional primer sequences if you've got 'em. Periodt 👑

---

🫶 FEEDBACK 🫶

💌 Mailing Lists 💌

Not me saying user feedback is an integral part of the evolution of this and other Bioperl modules 😭 it truly is tho. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated, fr fr 🥹

bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

🆘 Support 🆘

Please direct usage questions or support issues to the mailing list:

bioperl-l@bioperl.org

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible. Basically: give them the whole lore, not just the teaser 🙏

🐛 Reporting Bugs 🐛

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:

https://github.com/bioperl/bioperl-live/issues

Go snitch on the bugs, bestie, they deserve it 💅

---

👑 AUTHOR 👑

Florent Angly <florent.angly@gmail.com> — iconic, we stan 🎀

---

📖 APPENDIX 📖

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _ (iykyk 🔥)

🧚 new 🧚

Title   : new()
Usage   : my $amplicon = Bio::SeqFeature::Amplicon( -seq => $seq_object );
Function: Instantiate a new Bio::SeqFeature::Amplicon object
Args    : -seq        , the sequence object or sequence string of the amplicon (optional)
          -fwd_primer , a Bio::SeqFeature primer object with specified location on amplicon (optional)
          -rev_primer , a Bio::SeqFeature primer object with specified location on amplicon (optional)
Returns : A Bio::SeqFeature::Amplicon object

So like, -seq, -fwd_primer and -rev_primer are all optional, and you get back a fresh Bio::SeqFeature::Amplicon object. Manifesting it ✨

💜 fwd_primer 💜

Title   : fwd_primer
Usage   : my $primer = $feat->fwd_primer();
Function: Get or set the forward primer. When setting it, the primary tag
          'fwd_primer' is added to the primer and its start, stop and strand
          attributes are set if needed, assuming that the forward primer is
          at the beginning of the amplicon and the reverse primer at the end.
Args    : A Bio::SeqFeature::Primer object (optional)
Returns : A Bio::SeqFeature::Primer object

Get it or set it, your call 🫶 And when you're setting it, the primary tag 'fwd_primer' gets added to the primer, plus its start, stop and strand attributes get set if needed — assuming the forward primer is at the beginning of the amplicon and the reverse primer is at the end. Assumptions, but make them correct ones 💅

🩷 rev_primer 🩷

Title   : rev_primer
Usage   : my $primer = $feat->rev_primer();
Function: Get or set the reverse primer. When setting it, the primary tag
         'rev_primer' is added to the primer.
Args    : A Bio::SeqFeature::Primer object (optional)
Returns : A Bio::SeqFeature::Primer object

Same energy, reverse direction 🌈 Get or set the reverse primer; when setting, the primary tag 'rev_primer' gets added to the primer. Simple, clean, slay.

---

perl v5.32.1 · 2021-08-15

That's the whole page bestie, and yeah, this version of the docs was served up by perl v5.32.1 back on 2021-08-15, from the Bioperl live source tree 💖 Thanks for reading, mwah 🎀